Skip Navigation
Skip to contents

Restor Dent Endod : Restorative Dentistry & Endodontics

OPEN ACCESS

Articles

Page Path
HOME > Restor Dent Endod > Volume 48(2); 2023 > Article
Research Article Effects of CTHRC1 on odontogenic differentiation and angiogenesis in human dental pulp stem cells
Jong-soon Kimorcid, Bin-Na Leeorcid, Hoon-Sang Changorcid, In-Nam Hwangorcid, Won-Mann Ohorcid, Yun-Chan Hwangorcid
Restor Dent Endod 2023;48(2):e18.
DOI: https://doi.org/10.5395/rde.2023.48.e18
Published online: April 28, 2023

Department of Conservative Dentistry, School of Dentistry, Chonnam National University, Gwangju, Korea.

Correspondence to Yun-Chan Hwang, DDS, MSD, PhD. Department of Conservative Dentistry, School of Dentistry, Chonnam National University, 77 Yongbong-ro, Buk-gu, Gwangju 61186, Korea. ychwang@chonnam.ac.kr
• Received: January 4, 2023   • Revised: February 8, 2023   • Accepted: February 8, 2023

Copyright © 2023. The Korean Academy of Conservative Dentistry

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 2,006 Views
  • 36 Download
prev next
  • Objectives
    This study aimed to determine whether collagen triple helix repeat containing-1 (CTHRC1), which is involved in vascular remodeling and bone formation, can stimulate odontogenic differentiation and angiogenesis when administered to human dental pulp stem cells (hDPSCs).
  • Materials and Methods
    The viability of hDPSCs upon exposure to CTHRC1 was assessed with the WST-1 assay. CTHRC1 doses of 5, 10, and 20 µg/mL were administered to hDPSCs. Reverse-transcription polymerase reaction was used to detect dentin sialophosphoprotein, dentin matrix protein 1, vascular endothelial growth factor, and fibroblast growth factor 2. The formation of mineralization nodules was evaluated using Alizarin red. A scratch wound assay was conducted to evaluate the effect of CTHRC1 on cell migration. Data were analyzed using 1-way analysis of variance followed by the Tukey post hoc test. The threshold for statistical significance was set at p < 0.05.
  • Results
    CTHRC1 doses of 5, 10, and 20 µg/mL had no significant effect on the viability of hDPSCs. Mineralized nodules were formed and odontogenic markers were upregulated, indicating that CTHRC1 promoted odontogenic differentiation. Scratch wound assays demonstrated that CTHRC1 significantly enhanced the migration of hDPSCs.
  • Conclusions
    CTHRC1 promoted odontogenic differentiation and mineralization in hDPSCs.
Conventional endodontic procedures include the removal of inflamed pulp and its replacement with synthetic materials. The extrusion of endodontic materials into the periapical tissue can result in a foreign body reaction [1]. Non-vital teeth can no longer sense environmental changes, making it more likely for patients not to notice caries progression. Dental pulp vitality is also advantageous because it preserves the possibility of dentin regeneration to a limited extent. Reparative dentin formation is essential for apical closure and dentinal wall development in immature permanent teeth. If restorative treatment is inadequate, endodontically treated teeth may lose their structural integrity, increasing their vulnerability to masticatory forces [2]. Endodontic therapy often leads to discoloration produced by the filling material, which impairs the esthetics of treated teeth [3]. Maintaining pulp vitality also prevents bacterial infections, thereby reducing the risk of apical periodontitis [4,5]. Therefore, instead of the currently available methods of endodontic treatment, it would be preferable, if possible, to be able to maintain or restore dental pulp vitality [6]. Vital pulp therapy, which encompasses pulpotomy as well as direct and indirect pulp capping, is a method of treating reversible pulpal injuries. It involves placing a protective dressing on the exposed pulp to prevent further trauma and facilitate repair and healing [7]. Vital pulp therapy has been the focus of substantial attention during the last 40 years, in terms of both its biological and clinical aspects [8,9,10,11], but the scientific basis of vital pulp therapy remains a topic of debate [12,13]. Specific treatment modalities that stimulate biological processes and lead to a reparative dentinogenic response are paramount.
Collagen triple helix repeat containing-1 (CTHRC1) is a 30 kDa secreted protein that promotes migration [14]. It is highly conserved between lower chordates and mammals. CTHRC1 expression was initially observed in rat tissue repair [15,16]. CTHRC1 is characteristically expressed by activated fibroblasts associated with wound healing and cancer-activated fibroblasts [17,18]. Studies have shown increased expression of CTHRC1 at the protein level in diseased and injured arteries, implying that CTHRC1 may contribute to vascular remodeling as part of tissue repair after injury through its ability to promote cell migration. Angiogenesis is a vitally important and transiently activated response to tissue injury [19]. Studies have recently demonstrated the involvement of CTHRC1 in adipogenesis and bone metabolism [18,20,21].
However, no studies to date have investigated the effect of CTHRC1 in the pulp dentin complex. Dentin is a similar tissue to bone in the body, and pulp tissue is encapsulated with bone. Therefore, angiogenesis is a very important factor for the maintenance of pulp vitality. In this context, the present study investigated the effect of CTHRC1 on odontogenic differentiation and angiogenesis in human dental pulp stem cells (hDPSCs). The hypothesis was that CTHRC1 would induce odontoblastic differentiation, mineralization, and angiogenesis in hDPSCs.
Cell isolation and culture of hDPSCs
hDPCs were purchased from CEFO Co. Ltd. (Seoul, Korea) and cultured in alpha minimum essential medium (α-MEM 1×; Gibco Invitrogen, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Gibco Invitrogen) and 1% antibiotics (100 mg/mL streptomycin and 100 U/mL penicillin; Gibco Invitrogen) in a humidified atmosphere containing 5% CO2 at 37°C. These incubation conditions were maintained for all cell culture steps. The medium was refreshed at 3-day intervals until the formation of confluent cell monolayers. Subculture was performed after confluence was reached, subculture was performed, and cells from passages 3 to 6 were used for experiments.
CTHRC1 preparation
CTHRC1 human HEK (10 µg) was purchased from Prospec-Tany Technogene Ltd. (Ness Ziona, Israel). The CTHRC1 was diluted with deionized water, creating a working stock solution with an approximate concentration of 0.5 mg/mL, and the lyophilized pellet was allowed to dissolve fully. Aliquots of CTHRC1 were stored at −20°C before use.
Cell viability
CTHRC1’s effect on hDPSC viability was tested using an Ez-Cytox Enhance cell viability assay kit (DoGenBio, Seoul, Korea), following the manufacturer’s manual. hDPSCs were seeded on 96-well plates at a density of 1 × 104 cells per well, followed by incubation for 24 hours. The cells were treated with CTHRC1 at concentrations of 5, 10, or 20 µg/mL for 3 days. Next, 10 µL of Ez-Cytox reagent (DoGenBio) was added to each well, followed by a 2-hour incubation period. In each well, the absorbance at a 450-nm wavelength was measured using a spectrophotometer (Multiskan GO Microplate Spectrophotometer; Thermo Scientific, Waltham, MA, USA).
RNA extraction and polymerase chain reaction (PCR) assay
hDPSCs were seeded on 6-well culture plates at a density of 2 × 105 cells per well, followed by stimulation with CTHRC1 at a concentration of 10 or 20 µg/mL for 5, 7, and 10 days. The TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and the AccessQuick RT-PCR System (Promega, Madison, WI, USA) were used to perform total RNA extraction and complementary DNA synthesis. Quantitative real-time PCR was carried out in triplicate for each sample using the Quanti-Tect SYBR Green PCR Kit (Qiagen, Valencia, CA, USA). Bioneer (Daejeon, Korea) carried out the synthesis of all primers. Relative gene expression was quantified with normalization to the level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression as a control. The 2−∆∆Ct method was used to analyze gene expression data [22]. The primer sequences are shown in Table 1.
Table 1

Primer sequences used for real-time polymerase chain reaction

Gene Primer sequences (5′-3′)
DSPP Forward: GGGAATATTGAGGGCTGGAA
Reverse: TCATTGTGACCTGCATCGCC
DMP-1 Forward: ATGCCTATCACAACAAACC
Reverse: CTCCTTTATGTGACAACTGC
FGF-1 Forward: AAGCCCGTCGGTGTCCATGG
Reverse: GATGGCACAGTGGATGGGAC
VEGF Forward: CTACCTCCACCATGCCAAGT
Reverse: GCAGTAGCTGCGCTGATAGA
GAPDH Forward: CATCACCATCTTCCAGGAG
Reverse: AGGCTGTTGTCATACTTCTC
DSPP, dentin sialophosphoprotein; DMP-1, dentin matrix protein 1; FGF-2, fibroblast growth factor 2; VEGF, vascular endothelial growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Alizarin red S staining assay
hDPSCs were seeded at 3 × 104 cells per well on 24-well plates and cultured in α -MEM (containing 10% FBS, streptomycin 100 mg/mL, and penicillin 100 U/mL), with a 24-hour incubation. For the experiments involving mineralization, α-MEM supplemented with 10% FBS was added, and the cells were cultured in OM medium (50 µg/mL of ascorbic acid (Sigma-Aldrich, St. Louis, MO, USA) and 10 mmol/L β-glycerophosphate (Santa Cruz, Dallas, TX, USA) before treatment. Cells were divided into a control group (OM was added to the culture medium) and the CTHRC1 group (OM with the addition of CTHRC1 [5, 10, 20 µg/mL respectively] to the culture medium as pretreatment) and cultured for 21 days. The medium (either fresh OM or OM with CTHRC1) was changed every 2 days. After 21 days, the cells were washed with Dulbecco’s phosphate-buffered saline (DPBS). The cells were fixed in 70% ethanol and stained with 300 µL of 2% Alizarin red S staining reagent (LIFELINE Cell Tech, Frederick, MD, USA). A photograph was taken after the staining reagent was removed. A quantitative analysis was performed by measuring absorbance values at a 580-nm wavelength after the addition of 10% cetylpyridinium chloride (pH = 7.0) to the samples.
Scratch wound assay
hDPSCs were seeded on 6-well plates at a density of 7 × 105 cells per well and incubated for 24 hours. The cell monolayer was manually scratched with a 200 µL yellow plastic pipette tip and washed with DPBS. The cells were pre-incubated with CTHRC1 (10 or 20 µg/mL) or without CTHRC1 for a 24-hour period prior to being scratched across the well. The wounded cell monolayer was permitted to heal for 0 or 24 hours, either treated with or without 10 or 20 µg/mL CTHRC1. Images of wound healing were taken using an inverted microscope (Olympus, Tokyo, Japan). The wound closure rate, which was measured and expressed as a percentage of the initial wound length at the time of the scratch using the ImageJ program, was used to quantify cell migration.
Statistical analysis
Each experiment was performed 2 or more times, consisting of independent tests conducted in triplicate. One-way analysis of variance was performed, and the Tukey post hoc test was used to evaluate the statistical significance of differences. GraphPad Prism version 5.0 (GraphPad Software Inc., San Diego, CA, USA) and SPSS version 25.0 (IBM Corp, Armonk, NY, USA) were used for analysis. Differences were considered significant at p < 0.05.
Effects of CTHRC1 on the viability of hDPSCs
The viability of hDPSCs cultured with different concentrations of CTHRC1 (0, 5, 10, and 20 µg/mL) for 48 hours is shown in Figure 1. Cell viability was significantly lower in the group treated with 20 µg/mL CTHRC1 group than in the control group (p < 0.05).
Figure 1

The effect of CTHRC1 on the viability of hDPSCs was measured using the WST-1 assay. Cells were incubated with increasing concentrations of CTHRC1 (0, 5, 10, and 20 µg/mL) for 48 hours. Cell viability was significantly lower in the group that was treated with 20 µg/mL CTHRC1 than in the control group (p < 0.05).

CTHRC1, collagen triple helix repeat containing 1; hDPSCs, human dental pulp stem cells.
rde-48-e18-g001.jpg
Effects of CTHRC1 on mRNA expression of odontogenic and angiogenic markers in hDPSCs
The effects of CTHRC1 on odontogenic differentiation and angiogenesis in hDPSCs were analyzed by quantifying the expression levels of marker genes (dentin sialophosphoprotein [DSPP], dentin matrix protein 1 [DMP-1], fibroblast growth factor 2 [FGF-2], and vascular endothelial growth factor [VEGF]) using real-time PCR. The hDPSCs showed no significant differences in DSPP and DMP-1 mRNA expression levels (Figure 2).
Figure 2

The effects of CTHRC1 on odontogenic differentiation and angiogenesis in hDPSCs. DSPP, DMP-1, FGF-2, and VEGF expression determined using real-time-polymerase chain reaction. Higher mRNA expression of DSPP and DMP-1 was displayed in hDPSCs treated with 10 µg/mL CTHRC1 in a 10-day culture. However, there was no statistically significant difference.

CTHRC1, collagen triple helix repeat containing 1; hDPSCs, human dental pulp stem cells; DSPP, dentin sialophosphoprotein; DMP-1, dentin matrix protein 1; FGF-2, fibroblast growth factor 2; VEGF, vascular endothelial growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
rde-48-e18-g002.jpg
CTHRC1 promoted mineralization in hDPSCs
Alizarin red S staining was carried out on cells stimulated with 0, 5, 10, and 20 µg/mL of CTHRC1 for 21 days to determine the mineralization effect of CTHRC1 in hDPSCs (Figure 3A and 3B). Following induction, treatment with 20 µg/mL CTHRC1 significantly increased calcified nodule formation compared to the control group and the group treated with 5 µg/mL CTHRC1 (p < 0.05).
Figure 3

Results of Alizarin red S staining (21 days). (A) Cells were treated with or without CTHRC1 (5, 10, or 20 µg/mL) in OM medium (50 mg/mL ascorbic acid, 10 mmol/L β-glycerophosphate). (B) The formation of mineralized nodules and calcium deposits significantly increased at 5 and 20 µg/mL concentrations of CTHRC1 (p < 0.05).

CTHRC1, collagen triple helix repeat containing 1.
rde-48-e18-g003.jpg
CTHRC1 promoted cell migration of hDPSCs
hDPSCs were treated with CTHRC1 at 10 and 20 µg/mL for 24 hours. As depicted in Figure 4, the wound healing assay showed that CTHRC1 treatment led to significantly greater healing over the scratch than was observed in the control group (p < 0.05). The extent of wound closure also showed a significant increase in both the control and CTHRC1 groups from 0 to 24 hours (p < 0.05).
Figure 4

CTHRC1 promotes cell migration of hDPSCs. (A) Scratch wound healing assays were performed in hDPSCs treated with CTHRC1. Representative microscopic views at 0 and 24 hours are shown. (B) The quantitative analysis of the decreased gap area after 24 hours shows a significant difference. Different capital letters denote significant differences among treatment groups at the same time. Different small letters denote significant differences in each group over time from 0 to 24 hours (p < 0.05).

CTHRC1, collagen triple helix repeat containing 1; hDPSCs, human dental pulp stem cells.
rde-48-e18-g004.jpg
The pulp healing process involves complex molecular and cellular interactions. After a severe injury, dental pulp stem cells must differentiate into secondary or replacement odontoblasts, followed by dentinogenesis, for the dentin-pulp complex to regenerate. Dental pulp stem cells have the ability to renew themselves and differentiate into multiple lineages [23]. A complex network of signaling molecules, pathways, and receptors regulates this process of cellular differentiation [24].
Several studies have shown that CTHRC1 is associated with numerous physiological and pathological processes, including the formation of new bone, morphogenesis during development, inflammatory arthritis, and the progression of cancer [25,26,27]. One study showed that CTHRC1 transgenic mice exhibited a higher bone mass increase due to elevated osteoblast bone formation, while CTHRC1-deficient mice showed lower bone mass [21]. However, little is known regarding the effects of CTHRC1 on the odontogenic differentiation of hDPSCs.
The aim of this study was to provide evidence supporting CTHRC1 as a potential candidate for effective dental pulp complex regeneration therapy. Therefore, we first examined whether CTHRC1 could enhance cell mobility without impacting cell proliferation. We also performed wound healing assays to validate that recombinant CTHRC1 increases the speed of healing. The cell migration assay confirmed that CTHRC1 enhanced cell mobility relative to the control group. Furthermore, the data on proliferation demonstrated that recombinant CTHRC1 did not significantly affect the proliferation of hDPSCs up to a concentration of 10 µg/mL. Next, in the wound healing model, 10 µg/mL CTHRC1 achieved satisfactory wound healing. These results provide evidence that recombinant CTHRC1 is capable of promoting wound healing.
Angiogenesis is the most crucial step during the healing process, as it ensures the delivery of oxygen and nutrients to the injured area. The expression of various vascular growth factors and modulators, including VEGF and FGF-2, regulates angiogenesis [28]. In the present study, CTHRC1 did not affect the expression of VEFG and FGF-2 in hDPSCs. It seemed that CTHRC1 exerted a chemotactic effect on hDPSCs, but no effect on angiogenesis.
The mRNA expression levels of the odontogenic markers DSPP and DMP-1 were quantified as a measure of odontogenic differentiation in hDPSCs after CTHRC1 treatment [29]. During the formation of dentin, DSPP and DMP-1 are involved in the nucleation and formation of hydroxyapatite [30]. The mRNA expression of these markers was upregulated. DSPP and DMP-1 belong to the small integrin-binding ligand N-linked glycoprotein family. DMP-1, which is expressed early during the process of osteoblastic differentiation, plays a role in the matrix mineralization of bone and dentin [31]. Generally, tooth formation is achieved through angiogenic-odontogenic coupling [32]. The results of this study are not consistent with previous studies. Studies have shown that CTHRC1, as a secreted protein, promotes tumor invasion and metastasis via tumor angiogenesis [33]. The effects of CTHRC1 are exerted through several signaling pathways, including transforming growth factor-β, Wnt, integrin β/focal adhesion kinase (FAK), Src/FAK, mitogen-activated protein kinase kinase/extracellular signal-regulated kinase (ERK), phosphoinositide 3-kinase/AKT/ERK, hypoxia-inducible factor-1α, and protein kinase C-δ/ERK [33].
In summary, extracellular CTHRC1 did not affect angiogenesis, but might have accelerated odontogenic differentiation in hDPSCs. This may be due to differences in cell types. hDPSCs have a higher propensity for odontoblastic differentiation than angiogenesis, compared to tumor cells. Further in vivo and in vitro studies are necessary to identify the signaling pathway that caused those outcomes. The experimental results show that angiogenesis and the odontogenic differentiation of hDPSCs, which are required for pulp regeneration, were not properly achieved. Thus, the CTHRC1 used in this study seems unsuitable as a material for pulp regeneration.
The data indicate that CTHRC1 had no significant effect on the proliferation of hDPSCs, except at the highest dose (20 µg/mL). Calcific nodule formation was increased by 20 µg/mL CTHRC1. Further, a 10 µg/mL concentration of CTHRC1 promoted cell migration of hDPSCs.

Funding: This research was funded by a Chonnam National University (GN: 2020-1833) and National Research Foundation of Korea grant funded by the Korean government (NRF-2020R1F1A1048271).

Conflict of Interest: No potential conflict of interest relevant to this article was reported.

Author Contributions:

  • Conceptualization: Hwang YC.

  • Data curation: Kim JS.

  • Formal analysis: Lee BN.

  • Funding acquisition: Hwang YC.

  • Investigation: Kim JS.

  • Methodology: Kim JS.

  • Project administration: Oh WM.

  • Resources: Hwang IN.

  • Software: Chang HS.

  • Supervision: Hwang YC.

  • Validation: Lee BN.

  • Visualization: Chang HS.

  • Writing - original draft: Kim JS.

  • Writing - review & editing: Hwang YC.

  • 1. Nair PN. On the causes of persistent apical periodontitis: a review. Int Endod J 2006;39:249-281.ArticlePubMed
  • 2. Goto Y, Ceyhan J, Chu SJ. Restorations of endodontically treated teeth: new concepts, materials, and aesthetics. Pract Proced Aesthet Dent 2009;21:81-89.PubMed
  • 3. Glickman GN, Koch KA. 21st-century endodontics. J Am Dent Assoc 2000;131(Suppl):39S-46S.ArticlePubMed
  • 4. Lin LM, Di Fiore PM, Lin J, Rosenberg PA. Histological study of periradicular tissue responses to uninfected and infected devitalized pulps in dogs. J Endod 2006;32:34-38.ArticlePubMed
  • 5. Rocha CT, Rossi MA, Leonardo MR, Rocha LB, Nelson-Filho P, Silva LA. Biofilm on the apical region of roots in primary teeth with vital and necrotic pulps with or without radiographically evident apical pathosis. Int Endod J 2008;41:664-669.ArticlePubMed
  • 6. Valderhaug J, Jokstad A, Ambjørnsen E, Norheim PW. Assessment of the periapical and clinical status of crowned teeth over 25 years. J Dent 1997;25:97-105.ArticlePubMed
  • 7. Maurice CG. American Association of Endodontists. An annotated glossary of terms used in endodontics. Oral Surg Oral Med Oral Pathol 1968;25:491-512.ArticlePubMed
  • 8. Baume LJ. The biology of pulp and dentine. A historic, terminologic-taxonomic, histologic-biochemical, embryonic and clinical survey. Monogr Oral Sci 1980;8:1-220.PubMed
  • 9. Granath L. Pulp capping materials. Biocompat Dent Mater 1982;2:253-267.
  • 10. Schröder U. Effects of calcium hydroxide-containing pulp-capping agents on pulp cell migration, proliferation, and differentiation. J Dent Res 1985;64:541-548.ArticlePubMedPDF
  • 11. Stanley HR. Pulp capping: conserving the dental pulp--can it be done? Is it worth it? Oral Surg Oral Med Oral Pathol 1989;68:628-639.ArticlePubMed
  • 12. Berman MH. Pulpotomy: the old reliable pulp therapy. Dent Today 1996;15:60.
  • 13. Stanley HR. Criteria for standardizing and increasing credibility of direct pulp capping studies. Am J Dent 1998;11:S17-S34.
  • 14. Durmus T, LeClair RJ, Park KS, Terzic A, Yoon JK, Lindner V. Expression analysis of the novel gene collagen triple helix repeat containing-1 (Cthrc1). Gene Expr Patterns 2006;6:935-940.ArticlePubMed
  • 15. Pyagay P, Heroult M, Wang Q, Lehnert W, Belden J, Liaw L, Friesel RE, Lindner V. Collagen triple helix repeat containing 1, a novel secreted protein in injured and diseased arteries, inhibits collagen expression and promotes cell migration. Circ Res 2005;96:261-268.ArticlePubMed
  • 16. Tang L, Dai DL, Su M, Martinka M, Li G, Zhou Y. Aberrant expression of collagen triple helix repeat containing 1 in human solid cancers. Clin Cancer Res 2006;12:3716-3722.ArticlePubMedPDF
  • 17. Duarte CW, Stohn JP, Wang Q, Emery IF, Prueser A, Lindner V. Elevated plasma levels of the pituitary hormone Cthrc1 in individuals with red hair but not in patients with solid tumors. PLoS One 2014;9:e100449.ArticlePubMedPMC
  • 18. Stohn JP, Perreault NG, Wang Q, Liaw L, Lindner V. Cthrc1, a novel circulating hormone regulating metabolism. PLoS One 2012;7:e47142.ArticlePubMedPMC
  • 19. Li J, Zhang YP, Kirsner RS. Angiogenesis in wound repair: angiogenic growth factors and the extracellular matrix. Microsc Res Tech 2003;60:107-114.ArticlePubMed
  • 20. Kimura H, Kwan KM, Zhang Z, Deng JM, Darnay BG, Behringer RR, Nakamura T, de Crombrugghe B, Akiyama H. Cthrc1 is a positive regulator of osteoblastic bone formation. PLoS One 2008;3:e3174.ArticlePubMedPMC
  • 21. Takeshita S, Fumoto T, Matsuoka K, Park KA, Aburatani H, Kato S, Ito M, Ikeda K. Osteoclast-secreted CTHRC1 in the coupling of bone resorption to formation. J Clin Invest 2013;123:3914-3924.ArticlePubMedPMC
  • 22. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001;25:402-408.ArticlePubMed
  • 23. Gronthos S, Mankani M, Brahim J, Robey PG, Shi S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo . Proc Natl Acad Sci U S A 2000;97:13625-13630.PubMedPMC
  • 24. Smith AJ, Lesot H. Induction and regulation of crown dentinogenesis: embryonic events as a template for dental tissue repair? Crit Rev Oral Biol Med 2001;12:425-437.ArticlePubMedPDF
  • 25. Ding X, Huang R, Zhong Y, Cui N, Wang Y, Weng J, Chen L, Zang M. CTHRC1 promotes gastric cancer metastasis via HIF-1α/CXCR4 signaling pathway. Biomed Pharmacother 2020;123:109742.ArticlePubMed
  • 26. Li J, Wang Y, Ma M, Jiang S, Zhang X, Zhang Y, Yang X, Xu C, Tian G, Li Q, Wang Y, Zhu L, Nie H, Feng M, Xia Q, Gu J, Xu Q, Zhang Z. Autocrine CTHRC1 activates hepatic stellate cells and promotes liver fibrosis by activating TGF-β signaling. EBioMedicine 2019;40:43-55.PubMedPMC
  • 27. Zhou H, Su L, Liu C, Li B, Li H, Xie Y, Sun D. CTHRC1 may serve as a prognostic biomarker for hepatocellular carcinoma. Onco Targets Ther 2019;12:7823-7831.PubMedPMC
  • 28. Presta M, Dell’Era P, Mitola S, Moroni E, Ronca R, Rusnati M. Fibroblast growth factor/fibroblast growth factor receptor system in angiogenesis. Cytokine Growth Factor Rev 2005;16:159-178.ArticlePubMed
  • 29. Papagerakis P, Berdal A, Mesbah M, Peuchmaur M, Malaval L, Nydegger J, Simmer J, Macdougall M. Investigation of osteocalcin, osteonectin, and dentin sialophosphoprotein in developing human teeth. Bone 2002;30:377-385.ArticlePubMed
  • 30. Suzuki S, Haruyama N, Nishimura F, Kulkarni AB. Dentin sialophosphoprotein and dentin matrix protein-1: two highly phosphorylated proteins in mineralized tissues. Arch Oral Biol 2012;57:1165-1175.ArticlePubMedPMC
  • 31. Balic A, Mina M. Identification of secretory odontoblasts using DMP1-GFP transgenic mice. Bone 2011;48:927-937.ArticlePubMed
  • 32. Matsubara T, Iga T, Sugiura Y, Kusumoto D, Sanosaka T, Tai-Nagara I, Takeda N, Fong GH, Ito K, Ema M, Okano H, Kohyama J, Suematsu M, Kubota Y. Coupling of angiogenesis and odontogenesis orchestrates tooth mineralization in mice. J Exp Med 2022;219:e20211789.ArticlePubMedPMCPDF
  • 33. Mei D, Zhu Y, Zhang L, Wei W. The role of CTHRC1 in regulation of multiple signaling and tumor progression and metastasis. Mediators Inflamm 2020;2020:9578701.ArticlePubMedPMCPDF

Tables & Figures

REFERENCES

    Citations

    Citations to this article as recorded by  

      • ePub LinkePub Link
      • Cite
        CITE
        export Copy Download
        Close
        Download Citation
        Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

        Format:
        • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
        • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
        Include:
        • Citation for the content below
        Effects of CTHRC1 on odontogenic differentiation and angiogenesis in human dental pulp stem cells
        Restor Dent Endod. 2023;48(2):e18  Published online April 28, 2023
        Close
      • XML DownloadXML Download
      Figure
      • 0
      • 1
      • 2
      • 3
      Effects of CTHRC1 on odontogenic differentiation and angiogenesis in human dental pulp stem cells
      Image Image Image Image
      Figure 1 The effect of CTHRC1 on the viability of hDPSCs was measured using the WST-1 assay. Cells were incubated with increasing concentrations of CTHRC1 (0, 5, 10, and 20 µg/mL) for 48 hours. Cell viability was significantly lower in the group that was treated with 20 µg/mL CTHRC1 than in the control group (p < 0.05).CTHRC1, collagen triple helix repeat containing 1; hDPSCs, human dental pulp stem cells.
      Figure 2 The effects of CTHRC1 on odontogenic differentiation and angiogenesis in hDPSCs. DSPP, DMP-1, FGF-2, and VEGF expression determined using real-time-polymerase chain reaction. Higher mRNA expression of DSPP and DMP-1 was displayed in hDPSCs treated with 10 µg/mL CTHRC1 in a 10-day culture. However, there was no statistically significant difference.CTHRC1, collagen triple helix repeat containing 1; hDPSCs, human dental pulp stem cells; DSPP, dentin sialophosphoprotein; DMP-1, dentin matrix protein 1; FGF-2, fibroblast growth factor 2; VEGF, vascular endothelial growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
      Figure 3 Results of Alizarin red S staining (21 days). (A) Cells were treated with or without CTHRC1 (5, 10, or 20 µg/mL) in OM medium (50 mg/mL ascorbic acid, 10 mmol/L β-glycerophosphate). (B) The formation of mineralized nodules and calcium deposits significantly increased at 5 and 20 µg/mL concentrations of CTHRC1 (p < 0.05).CTHRC1, collagen triple helix repeat containing 1.
      Figure 4 CTHRC1 promotes cell migration of hDPSCs. (A) Scratch wound healing assays were performed in hDPSCs treated with CTHRC1. Representative microscopic views at 0 and 24 hours are shown. (B) The quantitative analysis of the decreased gap area after 24 hours shows a significant difference. Different capital letters denote significant differences among treatment groups at the same time. Different small letters denote significant differences in each group over time from 0 to 24 hours (p < 0.05).CTHRC1, collagen triple helix repeat containing 1; hDPSCs, human dental pulp stem cells.
      Effects of CTHRC1 on odontogenic differentiation and angiogenesis in human dental pulp stem cells

      Primer sequences used for real-time polymerase chain reaction

      GenePrimer sequences (5′-3′)
      DSPPForward: GGGAATATTGAGGGCTGGAA
      Reverse: TCATTGTGACCTGCATCGCC
      DMP-1Forward: ATGCCTATCACAACAAACC
      Reverse: CTCCTTTATGTGACAACTGC
      FGF-1Forward: AAGCCCGTCGGTGTCCATGG
      Reverse: GATGGCACAGTGGATGGGAC
      VEGFForward: CTACCTCCACCATGCCAAGT
      Reverse: GCAGTAGCTGCGCTGATAGA
      GAPDHForward: CATCACCATCTTCCAGGAG
      Reverse: AGGCTGTTGTCATACTTCTC

      DSPP, dentin sialophosphoprotein; DMP-1, dentin matrix protein 1; FGF-2, fibroblast growth factor 2; VEGF, vascular endothelial growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

      Table 1 Primer sequences used for real-time polymerase chain reaction

      DSPP, dentin sialophosphoprotein; DMP-1, dentin matrix protein 1; FGF-2, fibroblast growth factor 2; VEGF, vascular endothelial growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.


      Restor Dent Endod : Restorative Dentistry & Endodontics
      Close layer
      TOP