Skip Navigation
Skip to contents

Restor Dent Endod : Restorative Dentistry & Endodontics

OPEN ACCESS

Articles

Page Path
HOME > Restor Dent Endod > Volume 29(5); 2004 > Article
Original Article MMP-1 and TIMP-1 production in MG-63 cells stimulated with Prevotella nigrescens lipopolysaccharide
Won-Kyung Yang1, Mi-Ri Kim2, Won-Jun Shon1, In-Bog Lee1, Byeong-Hoon Cho1orcid, Chung-Moon Um1, Ho-Hyun Son1
2004;29(5):-478.
DOI: https://doi.org/10.5395/JKACD.2004.29.5.470
Published online: September 30, 2004

1Department of Conservative Dentistry, College of Dentistry, Seoul National University, Korea.

2Department of Conservative Dentistry, Asan Medical Center, Korea.JFIFddDuckydqhttp://ns.adobe.com/xap/1.0/ Adobed     ! 1AQa"q 2#w8B36v7XRr$9bCt%u&Ws'(xy4T5fH  !1AQaq"2B Rbr#u67Ѳ3sTt5v8Sc$4ĂCÔ%UӅFV ?_Aנj- H>>,m*>fzp"TrKkr^r.|_&]|*vPuܶvoQ1mwVJUhu-I"=LniAƕ8"۲ k*ҿ[yu:.vUQ+)%F DHyVBk>Hy8jݹ q~9D4KRmzQ)^ʔ.J%k_tVi5NTjg!'ky|5asOȻ)R۸ߩFMԿ3L4j6dڜ#NIwUF]JqB/(FafJRzq3\G՛ ?~\ 6)6W4m[O^L0E&rRMض*C .]Unl-1 1r#Rj/&QɈ׉˩s6Rj=5Tg.y.·Pӡ:JJS:C8-2u]d&vUz;7p9 5VnL֢"y)">iי(IDDd| Yj0; LRfS:ktYK%*N2^m|&dğth":ey)uPQZW)gcC3Pv&MMWd&Ŵ۲mvTRoժM03*F3Yd6\8,\hݻ kߔi<k NTwSԪmljj[>->ptU%'LR>&EBH$MQAUx[$Z6vi&_a.KIQ{hyƒ j"JOC9eFҝfj;˚Ω<[3_m% lQ@4g=5$(J]Yc-OMq<Ǎ wSzڗ)k$7VIP붾ͯnV+卵*t]iЎD31~SA1éC2u)ʼnQn-Uoi3:grI8ؓWm*G zܕ)ZקJ}Y YlGeJ6cB2I NS3Q>k=KTBT]W6+SOXQgGR? telˊ%-Re\hѯ2TF"C/OJΩ6r[N.0{SpljjX1“jOsӥ;ҭhe}xu`Ք&.)yO̒ Fߑ.$Qw;9Iw2o+RVJMSOj[SoҌZ%;`d$blQ{Ro{Imڌ>3egf\O֝Uzx"䢸g+mv%Gʆ:|V[N'&ס-ޝ'kfE|K,G&˳98Juin/\\Qݿ̋v~Ǩ!rtWU d|E߫R4d}.qPw*Ӭv5YEcn~f5c%MTMkb-F>5JT,})QHg%{("ӔȸWMsYyWNRrkkJr0XドnͫT}r-jj,Ŕʍ\Q2Ri>v$5!]"JB2WɅ)]VԜUc8i|.jeRO6^V.¸ Q&#|ܶ-*uOG%JAtRZRr]FFG\۩w+?'zչSѧt jz>KW&ot{7P&2D;&\\>Q2JzܗAKSfeNn[jRrԕf6,q,F1tRfԗ>vֶևj-&R'Zi2=xv~Elbsvm8=ӛ"ū񕜈BȩlWau[]ٷBߨF~J!|Ipr3R̴#Yp)={7:G{+:\W}n|Q#%)7^-h"Ƒq:M*%J&$T軨I333׎g_- ucBwwjp[6i25$̏bU’ٱRv?G\~#Iͪb7<<}Ezt" q_Inw,7-d,G÷%T* Wg1"䥱kq/A.,_KhqŒxwvo u2ۥۧ.bQ}XκA$֣ +K״ZUNmڸII{.v{5z5ѮRme[moyƾd~cRݾK'j.\i&/S6f|b=5: p!6i_ 4j6=.si˧eƾtS^c.Y^RJVS-Vi3,esi08?H$GvZgg?gi䤟2adw릿:"۪lkSN>q-4kI܋ێe̊qۅgDoѨ9; #T.Q;7#~_Ufstb_'w~Xw1Xk,vcOt._}v}8"(4Z\ۘgk?J?bm_c!g{HZV]Fkk%~gEt)b秴vΰB|꽸}mp~E6ݹv;7P٤v+ri*3Ԣ|'O14_~7nP{7ZU\Vű[ +7󖱅o#:ǥŬ\|3r%TJX]V7ez¨Y]lc|O3V! R zbJ'PnGqVJ"19WVeOF埜EaEJωqCN5Z g-9[S<$sUK5b|7sn\7x qmv##FF\ w[=-43$^ooVSiXօv7iB۴yg>]Vf"r$J3""32!Zh[K%7GvNLs+4nB/B{vlsobJaҺJR:0g%&zR\ S3T[&ִor*ⷳc3ʊO[iozW٨%$gn:ܶWwFBԹjHP&z u&F2\f;ipW73 [; '_̽b;vib!oec dC-tS__$Xs]l9&z$2/N>%'[}b{h/{`{Ji׉׏ YJB/X%}.|+{(S:qz]4_Kѵo`^tY_4S#* ^zvݾMr+TrkQ g.8Ͽ^i>ӈǙvix>$o( ^qt*&t1oJVu-ql5U6jCЉmĻ*"?JT=K'O/|=Vo}l0b}}f?X[?/\JSBe,kP8ETJ==?.p5ފgbU9}ǶdNKk—_$8̸͓ۍ8Di\BԿ-1v{FF]|.^ۅ{vl12׏z7-R7wE?\nh\jN/Kձr_oBw"N QMBZqe-m:ӨSn6j4%!hQ;sv'm4kcM=!8\m[M4{SMliۇ%eֽR&N:{2A8)THLK3Zj[jPBx#BگMf:G1\`edcʮ?|w(-̮vXt,bW2;.ιNHRR#YwTM"<;mk\.foIDjmlJ;vxy7o7i\,KQŊ9d^Mmgc L*.T6tLeIuOH3SJQ3=F/ʿ<9\JM6mN6=<{xkP!F1QR[I$6ُimXu2An2yԒMU q f[IB-'䤯jYm52&JG\zд\~vdg QtHGXw&1Lw+nDEdC1w|YJmvP)HZ>i0BPβә?R:QO["]I_Jʏۍ>QKyu^bycBq4lXF~l [\*N>-J6,Gq(Zr5h]CwYӤU~ʶߑ u*SIv%ZfJ7)! FS*s_\|IŸZ)J ]ܜi4"z[+Z,MOZ))}|Ʀ(RUNIII.S'ˍO~˨rn}M)xxӕ0 eyҵ7YMAB]ӣU:/ѭ*6bcwP͵ "+qēVjŹO|GtY4V j[mLV M -m>",B$ GD1~j6O4|LxnNmqATNR3ε|DŽa[fmn-ڭ+FiK7Pcm;r5 l8r{#-]'nrFh2ruycb;pW=njRqRJ(d mnpckNnʹ+6]tz~E=ʕ l ZZ5jSi3#47.Lcfe`9؏v囜.F\-UZ:*0_<Νu9Lӵm&)_3\^ҹ3"1n1v_|uRʞͫr'iȧN_kH׺8xXrj=\МH)V\ˬ.Xʸ oVRC}ySU9/OBY먌5 ٿwޞ)rw8Ӫi5*5ZΗcGƱ !ZۄlmpjJ -l <R̵/JAպZuq\IdUS 48wXJJtcg4cI~aqߓwŷrm-v)G7yS^7H^-\mŌAq|"m9IBnF㏉9[N+mmy/!KKۉ%n +BdddfFF6FQRN-U5;Sv'm4kcM=Mn)\qιqUd9F%",6MGdT%-+~ f%+y֛^3SrF>6lc(֪vۊN;g._0Sѧ]ETWرkQKzGe9ʨsKA"yC y2\[5 rԭ7Gk5Mzw_4sM3hxЊ'oÍ5jsub )ͪ~tR2H]R͍>̋m6=%(˿(Wrr-܅y5(ܔJ޺YunW̹븹NsqK ]/QR#"ZMDfD|43Qw|._ԡSqTZBg??O Ϥ)/E_U|i}2 9Z?¹0:x'3,whǣ?C y-A~=daJј&M?D1_PS+Oi&;a @;Dž7[ zZC"bv:jjMQk$M RԸ3uA\=wI.AwC"^.{?-\NSiˏ"b}T/}q/ o.1M}R%:-ZniʒL$SgrBW*,Mw'N\ɇ{s\j]VryG'8f`}'N<*/`U숻z CwHq18J+vԕKss4R53/&XTt1bZƟo\=%nO)h$rBi-nKĪ^ ջڜlwkYm[̑+/QrZo%TQ;TLs($2C:s.%+eoNttq۰kK7O0m_t_pZ1SsSM7"mevFZ[w -FJ*T*jФQRg BSu|]g:ɵzjqwmltL.e3sRMچkSmjkmWœިm++¦'tILk*բQ D,PB\lI[9{%Gb R6öۍmX-MaʉA931cs..G4CujQտ[9 }G-xwl)IQz j Ó"rqe&=]꾧֎c)<kӳ+0JrRR3'TnXi^xMF Bު*tIL.[h"2"nKzZe'ZV/RrNYz]8죝n]Ķܩ>^Ժ]u-7^\mZjܣ9+Rmn ߑv?oꋘ?&ƪy^N4o=3-ؔ̿*`}V݁ ƒPu8%$ ݗ]wt;\y\>='OjPIp/nJU8{϶FNMsf"ίNqƹ(+ ݮF2Km |jܴZs%zf*eȫ?]4)I۵nR&FX + [jDh(#哑9q9Eծj8noǕZf\J-l&Z˫}`ӎhyrΉn\űn]9pʌӣ"׮Wt?N4_I_~54#/my1Xr*척aS#DT >q ssΛW;3oUaJSRMDgQnt:Ql,/ ܷfRqiM Ȼ>Cob;A>ڦWقM9X~/!'MW.}Vrߔꔵ!5|iB(0-zF=}okڢE$^wW~nokY߮\6՜̌{i-AF*9)\t9IV6۸5ZUF6R$ŨQIq砳YUZ]eyv >hI櫥N )&l JulwE1GDOuFN2| }馥uC1rޫV+^gdb&W[4<^e4YW,d|htͮsUM)۸8:{3d{AѢ)~ \#J=NdƮꮓ90 |1K$v*?мS ]i$J,C,SG?/_՜pMSƯM|mG1V1$~K>CSvkuj=&) -,yLjuFHK{c駗.SOua;BrSqj-ۍZ#'Jys7[g2z/.u4+XV2VQ.ޕ)$"(%)#Z7suZ%j }BǬݕe)Jvz8zJf:hIN|svO1O#IEcۍjݽ:SdὮvu^@:o^5cs>i/VqmVm]ؔܢn6'vޑ̗J4Wn@OlKbX ;n:hgJ9ŻyǑz8f܌q&Y fN0N;[69 rbׅC2/#kE l&2~èMR.*%g=Ft.%؝e8<.e=Uv{~㻏"EˑnvDѭ͜Lu3u0:U֝$[M5<:oi+V4V9 6nXvx&_ q Qqw3W:uϔ2yb/(ɳ|5zQiJ#r|Hw#.W?4aDŲ\ugWG;Cw鐢K|xg)##=O.dF˟jMUvWĻsr.z]kPc9"]R)mkfOd*uYf١RsB Aîh=k]ʳUrrZsq`d#r$/Ը3o^&lRWȍyuW̦Y4QDUMJ65ƒ[+ygk XK_±k#y:8(TJOSQhJt2.DR}"5[) r)6V6u5k:eXZmv𭤔!푊Q[qQ}ҹLE- 8qIZG|UM4j}Mܕ[Vwm{} Naqµ"ԈM zOpKѰ?IAD3Ir0'/q1itoB5{%wkOBn-ۜduqIzYK60{+DʕܞqIt";r1mG/\/ym[6JƫR \L=S=OT@Ix[TMm{>ݾտ֒ݸӉLYIx>+"JVNzx||5rI?C{oz8۹e\R-^\A2F R+N9 vlT]"ۭ d)t֞i #E2jB@׵=#/N+!ĕhx}I!cM`ąZ*ŻɄҒ߮Y.Z}='/oۙ3IpW̮hT7cTSuz9>B}΄&h!>lӵn~j˅IvU.'v'CSZw8QK3G> ,J59ٷ+HSg䧎hJdzvwv-cvxS5[̊n~ؿ%ַX?O0\6ne 6kn9.ϯ} *h 8_QhLݣ7q +=XBҲ5?[[)+F`=4 }B,sNg==u*Nj9k_GJ)+R~GSPBȒZ:(K]heL=vKPӢwq(NrG^ثϣ?#tC?.ͼ[ۅo؞y#%ǛjVyLSw%T*s92JTM%"YkQО.q)gCͲn8cgi6j1MѾ[{9h^vƘǚםidfi.^RHmg&rׇz:}݃}xT$ضk'5s-狶,\vpbPD،=Okf.c#cdz2FK5T!&)|ntD<+OŹU i-G[EE*FDfeaf2QƤM\UG_{ǹm%\yrGy:.\4wjPGUJޕUV7Do\7Vy_13w;[?c]H\$IJ,*L]3b%L{y.JRKG2sq,B6T}(#nW|km+q5] r㪍bJ@y{byz,b踊3ϻJ,'^xd،)JVw#.Vټc''ÝպWtbRؒJz۠8!o9IۄS95E9ؔ-e9JR{dmnッ<[~n${~Њ$W?&ՐY_? #a.ߑv?oꋘ?&ơ|y^N4o=3t=~7!/M3>n8W홎2M`Qx+ z qy8%]7_~540ۦ彷]Wq CѡwkďyF5Dum_}~P(5.(X,K9vᯐ?leB9;Jhm#3{CxGE-S{;@Fz˙]=O'!ɿ]' r`:7'2bЖ>Iy,/eTy/V<.H?UYY{\^#ѣr9^7?xoRȆ7EoS_&??zϾM?(~Q-K&>"~aߨ t7Emsϛ+?;fCr)fY+>z$tIkjn_>vnrֳki-˹l= t;'EyC¥|/BLwBJdgjۛ$s S1|ɍV%JI6KvəhzIlBYɒ|0"Sy0F>eo5W)O+X˻u';v)2vVq۳kۮws?UʑBǴYO漪e2MIjPAک\b1)DDؚKm6ZWΨgȕ۶yjڳ 2ضN[C[|r@9Jfo<_eI7q.|cÊV߷:i.:$ȋ)1%%)ADZCEBxJ0MJۥy(bNsKM9k43IwNt.\%N簤I'.j|ƃ2$grBEٌ\}9:v*!n7M(ɽ]7c@XxƱԨ37īf62cTTfFK]9wntQHͮvٱI/f|j=7}\_V5U^+:uljSȃY(XI.ȱmo1甅jڎIZ2>#\*:gY|4k\8ZwSqtyA!+];бޞKծË¥e)#5ap.QK^8VdU{*ѽL\=qmjnB5>{ Ӟ`v±5 ^k&O~Oshɷ,;6nOW>u6{RqS`)S%jp\ipdEBLfTWy$GIYw~䲭J.1vSY5z.V>^+Ǎvc.I[R{QsNR3ӎfhd>y?UJ*}~[e\i5U^͛E]G_FS(Iɿ]i8:4zj~շsW,ˆsy:%O}iur]iF5~3M:Ӟ#N06)4ߧgdawIotiz:1r5YDZLHBSi;NQc44la=Y kQIT*ըl:tq2(է9VO4뒳܂~2rq'nrVZŦ[t7\oլfb/mlpc.I8콚q^1iE~䰳mi[dۧw֤ICfdFeCsg:i| 6擣׋* 96lust^{%99UNRvaMܽo ammi$em4D6DD\nA%$$#}۷/ݕr99JMն[oT޲E"KTaP+HGkŴj5TM5xƱOS-k`ۛkٝWz;{kS}F;~q|~^_|euwnE'pSupUP)V]vE+t =ZRaVdG6= *.ϼnj9:UɷbېmF_tޫgHjVS'śǕًdkkѻ_]Kv?nT>)^e=Ar1'3ԔILyD?:-^in):{7.؂\.:V }#뺾.3r̸*xbFM aȵz 6SQ:ײj[ 8nn iFMw rR"5M5I旘35f^j='j:nNW.ʭocZvZKV^ɚJ.cM1ZI7E'6rg탸5oZ=[m Z`\hbMUR١Ȗĉ):Jin!_7Dй+f̷eKҷvͨBPR(V`y6tw*MRΝcB.ڭTnc;P$8nFvm4(D(R#R-L -2:FP lxZKQc6I("Km%$E, 78uXIFA$RQI$JbInG]c[ֹ:ZM+n^')JmJMJRu{e)7jQDw~%yQl}BZujSSf۩QZ+Dzhd5o%BIc'GZ?}΍:>Ɵivז-%݌J5MqGWTVʦh݇ܟ~Օ_6 n'{3~mϬj'J11OȻn߃r Qr\3y٘+WӍ'WxEs^O3 o~[|7>]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%-(\D4h{UK&ӡn^m]Fݢ:`δvj俜F+) y[{{ 7 tu>gvrěOj'5 iRg[ͶFjGe n~qT$ci ۚ0oԹc*jL[sVWqj\ݻ&6"WoK:cnWmrv)o>66(F>=W^bf#c zzʞtپy%mՉPël e}J.\Zk4ttt>oEM=q)hJjI=ͥ(%]脼_88ф;͛gWG;Cw~˘$4=uWdĜTثNDkiQL9U*O"4XP`02,Ge-k5$h>ܼ]3vr6!9RQPIVSnM(ۓ{>;/Qͱv{3&-[rc)ܚI$n{Sv3[j00)-D3z}MRzVQпj,T[uVs0\}Sid;r(ݝJ>æʺL&c[jPK0~d(FKÝW\m]GTcF|Iׁ)I3~#oX%vҦEݑؼ5Żv2qAZTE^..M{ʐfȏ2##.R}*KʛZz^ӞN*lPťLf\G6[WVQquV]XAi)5J!,$iJ6o$tPZc;Kjx_n3`qIelV~vLy{fn匋Ѿn%;zV.n'-ұdd2߽1bZksPe3TI9)$ԩIN9Vơ\=2885N\ p)/a柛w9g_lױo8ݷ iixJV& ғRi{N^_oAŮE6Y7I$Nk$|Q)-*4Z)^¸%4Qm [I%.c-OV+C֧R#%ѨCe3i;w$G+_dy| Fzj$DI(=OA gj%v/]8qԯNIS*֩',Q%\44ZZ%D|Ǧʴ6&vֵI$%8(ԬƾS&#Z. }6z?b/|Jl{ץv&mpx4Z$”ڝ4-H%dGKfM:sKSRWeJAn]>s6应-W9'H]'uȫYvgK^\czp|My\鏩w/ËQ.)]\QiS`8uL뚛̸=J"ܻi\å'-)54Ue]:K\퓡vK xwBqrH\*֕TnzC.mT=t-H]SČ~Nu╏NÅ3f|͡G~B+Xm[Q7U{9"~jgK Zoʰ7"qJ,ekSeNGgϳ] ^.6:s}_,%eRg<5⿨z{ZPun#jRІ.6g T.!]xa c#jN$Zpl̋H WZu8WmMRýsĮ?Mco~sx TU҆Q :KDG4n42.<3/'^?6/ܠڒ^yrrÿr2\D}}B]^E~^T cɛ7϶Y[<֞[7d}2%QPqOLEQR\CIsj1?\}%tJ0e~ *sk"*)&ۓEi#{1J8Hrt|'ܝRr8)=ƔN'RVz:cf]F7bZyZUȘ4x8,#JG̒?.W9XnO]KO]%]ƻ O5Γ/3qÓj؍/r̺rƵ 5\&m6h.xoeX[=<3%< lZ"2h\Z[&jW3ejm?k&[]ųj+{N{66leu_+lj]q* 7g*knأYv= q ەdxЬZ|%GUrQ3jLŒqET]1% qkXYūYc[7Ś]QY\jko\</Lc7+'hMSUc6qXyؙ~6#ѯv.0$BQi5YyIhɍiy=KD!n3Vm[V%W-B%swa97ajۗ m+9~]fKq|Ddaˑ0A]_v޺mM5* F-BYHJ5}q>ʉ.6hyDmpD׬'-_v5;5[8K[viJ.3dR:oYHHh9I7:۽fi+wm^ [)odPѱ52CZUJicSw\&_s0uBȍh32džzQflcd^m|7GѹE!fO5]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%5|Y:SJE\U-(a_cƣUǽXXKiȞNlmۊڭڄR!**ܤMeȽ$|X5(Ź\rJ~ܮ]>'HB0cp XFr_c?f?7<ukSgov¥iG>>䙗i.+t+bOjIܶ . i^:nm}s}(3>NZ$2Qg([".>i.ƾ)B̋M8+"- >eE6DݥJnJˣt׻ 5.˅nJGwZD~!i۶a,Db3ZQ3O#KO5/֍ozuK'GbRi᝘NV_ҝcvם ZoX}F6z 7e5_e:ۓj=AB+iܔERadMBq*ԯ DwI/Gy*mĥiRKg6skY/#SN4e$-yXM YL?^ĸNNӪ{$r1JJRSLO]Aqm>V/s[~i/j+m>z}eI"Qvp]{ZԼ:{vPAG2=T͡@ڐ#u"E*>C;o$~C#_d/HBq^YRٽzIKbOm\~żjFFGdiQ(*/i*#.FF]©m=BmpQQQSP&Ҫ!T&^>:y)$ˑÐFčI Bӡ-t!bM WҦŶ'UZ=}zvn~oT/\ǒ'nr8 AJIӆz<^uߖ4eFC1i+v!3qNyߕni?4JZlmYFXFۼO0B\m[ tʄU3s"Sr(NJ;SKW72L4̏BVdf^Ҹj\]ȱ۪(ӷm?J-KEmWڽ^4<8qu%9pŹW~877ܾeVгS(յe^C]yX͹! םm4FGȋ\y'Z FX7e)|Gjt߹#gb\ŧq_([R8[qU$Z (ʻezV2V!iQ,i$JE˂٩ a(GK'O{vnBvryRd-RK4=qxZJMl_CuuIz @Rt㮽޳!|68\-l[џ84-2Pu" RJ_^OL>G1~XnBŬw6J0*Uvlږ1N G1q9IUm*'oWu][&UyYZbBZRZNfEJf"+2nF~Eû7n1xv.RUM$6 lAxSQJ&n5ܞwlEói"#>4׿Q.nEq7Oko[1wg8ZQwZYiqtm&~">Bo?w͡ni2峋NCEy Ҕ+%ZJ ʩq*fpˤl,~^Mχk1+:ݕ z&Y`KLӪУDr3[*Z :(SL&ݻ۬Vqsyԭs x|iI߽zZrg.:mp%6ԜvgmpIUt;QbS.Է) ǨKSV,*lڌ|5Jt3#NP.=+OZ~/G سIgbꥹJnl_DUM\iM!֔wVZuԺ,yV.Q>f v:݇WiaŸN5Ҕ[M7SsrvǣrMW= \8ZW-jsnڕ.ZnF2qt ً[ٻޘY۷Zm"Jxr&NAfA-݌to9s359݆mZ+N1-qS$D=17 x׵+%_ ve4ir6Z$FDڗnFtOr'7'{9C˨ꤡaYoace{Refnft RR"4%ʌm:Sj3)OdInTO>X'vxV#jܮw9Fog;5.~Y5\~18YQܹvj4+~t7S ﬕs %^۵ڴDZV69R^Y+rj$ԇoJKR5wB9C>Y:l+EǎS{ʲ{T6Wi* ^^9k/y/Cs\g*qڵgn4T8mERr|Ti+iPe;;.i\EBEJ 丬i9ɧM-ԼsGDrZ>r#R>~X9y4b棇9JwV۔%m(b[Tjvl}۩~nDԺ{Zo-YuK1vx.nWuO+jN [ٮ0%"΢CdTJK-RަH"$I(*ve &҉FzB,_Vpqp9m8werv')E;o&QE׵^d9˦j\_,ڵugZȻ̧8k+jK{wmr@3ӭ2 wFkzFVqs1؛.v'I%$[iT]D5Dl2 nk7qUxԫLS+sا3/ΖeZYK<["%-g/kRs:f3;*E ت wJ%)5&+&rw*霣i|sMҴ|;R+fm䡩.!**dӶ-6s6,]zAXMWjmnz%SJߴm2UXw7MQ%<!tKys#P,W>s;3IYwx<+i_\\\U6 u7P|xbn_k&ӓVOe䦒 VUr,-㘘"-LZeOSҠթrEvq8Kf%5%&K"#%vD/.ZYYŏ+p$nZkvއuW9㓱Z G wYIFyf)?ƎUm5ԉ/'k84{KO:rQI}XRuԪ|*lu)3qZ[mSm5R3".Xcَ5c®ࢫI*۳~wRϿQWޝ(EJrri&ۥ^ʶ齲Im|[yb;mnm֩uiܘq>E+Ikx߄3r33-5𹻖09ϖ9[Tz~mr5NsWl$oPusޛ^{Z;);sڹf\3oٹZmԉ/'k84{NO:rQIBø8Bݱ3n֤DiK4u& ofSȒܩx<˘|N0Fչ]qsp"}! QWw@t4ӭ+cO5%]'*{eM߲DRO1y*q8w++e!c߶ܪlZWّM欼 CQ̼빶lX{vib/V/ ai;x6~]+z]MWB>re-:lgk}պ!#9?%܋V-c[z!W?c7YNm/jRr[HOzԻefճ0q15Zp#rkQQ0tU-AmڵP/cȕ?0cZYj;:0ZM=D6g ?'UN+ձ[K ܖB2'xq9{|۫N0ku 7xaj;n\ 2[VznMlWiKbSk))f..)Km)&bGZ=>OR܍W:j'rM'wYz&/鶧{Sʵb"vջq[I-ՌZH._x*BagC'T(Q:$ͳQcMCKy?3g'ߝqnT);qs #ؤZ}OOI:cfnc8W~qy.;^pVl]Hԓ>^H^@7-AA܃nmL(uWܻS߿ Td95Bdh4t6*dDh!EhI[iŨ\L.&Nc ܮf^;$R)\rip9I|ٺ?#R.ZDZ;/]nݻqs\QE9M&Bd ]N mN*D>tgbK>+ˏ.!23]BȔR1ɝ^j'k2ƮqBQq[$di]icV/e`޵B.FIIJqbi>Ӥ|p; 6${)RU>_e}^dzdfzi %ekRVUS?6'hׂ)5.\+qUgzE2C˷ecŏ^֔ibk shesFWJ#~> Wk~ݨ}ڶ>ơǚ)׽ZƉo~B-ڼrvoE:Ʃ3ۣK7+Y`WirS):{>ڛ}:wԨ(J_";6R%[u&ƫdZ_\'np| RJwNeTW,=rrbnkڄ[M3ܴz)3- R.?:okۼ0TU'w{6&w7j1z3ON'fGoO?)S_bQ_¿R(^ԴԴG.EtMڇ&RUiW uQjU> Kiu1d<ѥIQ'RQ1:O/lŗᏩiʂv&Jc{D5 Tt)1.n[n۶X}RjqnOʽ(~[Ns{ސ⛌uO,kgo֢dRNQȄ .'6W!׌P朼tdZjFGE"]K@'i۪N;sI[{SOzk>`rRR+!σj8&TjlvA̷Q?HyjyLHNտJMjܶT۽lG?SnKN%<‘ nq[N0Sq[Ta(&t(|HGO~gvkݻTR4&Z$#ViOY1r$6YF?e4U/Mvxų:zbU^gQQ+NW_'4jfz^c'#`rvrڡ(IJ/J ݦ6 ]-CW |_{v*_q3^DZ}Ic6Uڌ8p7{crZq5ki`)mU6|-Z5^iEz3P=:Cu7DF'k%}<C-޹ֲ̱#\,(f88%X-N(ck0VLR~} G"-8ӏ/ϰKq?(#nrVTmZ;zióM4 m |UT'C^_1X.gXM{%ʤd 4\ovN":"y-,T)fLQgۢr=/CƹǨJVr[a+!rT|%Y\ٱzsS>jͱ.oOc6f$q% ǒGo;n[];ߎjrk{~\VۓNIGn:iqxo |~t5)Rxעri{Vi&NUOl_ѮMfsޕkЄay.0P{7N((BaIP$ K"U6Gl ݙqJRu+qN$ m#*p<|{:>-Ev=86N*MM긭U*uѾ?/^o7;'u,h4݌xښRM:5.(/ \իU.{F^rmF-Jɷ.>Q"[4xT^OZ~mK}T0ݛ^SAo9u?lX(' qj%=X}"^e4wˠ|rܫ 6I\Ķ;Ӻw!'ڍWg{ i U_9Avhۣƾ+:vs/MK[ɭīe{`Zgb}r[i'GE2J7Nez579wRq+Un ]J.cJ4M:h箽Wxxm^ pc\wcN%'My $$| :$Fqɏ¾^қP9J6Wxvu}ݵP>Z'FFdg"-; [¢cmWkÎT8nG%ݣ7*\խCLRYZͤiD&J#'ehbSyXK|y*ӞpS̍R`[pTr/Eg)K+92{_ n3zwz'oŸۤ+sOj J:`T>Cf*lwd\fYOP"R E֢̔L4ɥ :;.b(B02rJ蠟9>V'9M%)IqnhP<%,r'P/vNSwr#w"ݨaqc(|{kd=^0jTMR2ULNz|.<|^PfY22##!,K~E BEJۜ&jRNsHަޛg\r,v؜.jK3)[EJ2ii{KEiHP^&]Gn8x=K}Wx/KI9-ϵwQ%spܾ[^R}S3$qvq8M[ ozKxcqmJ/ӿ{_}7&ݨ\f6ZSyQz& 7ۉ[8~UNn|nkiTB+4RI8'Nc%tn{!]Ȋo.nEmʱn𵵥J A+wy#+ikǒڂ;՛s85'KmE:Ђu""Iģ5p=БbTY-ͽڔ詻ngL2Q}$de# fs^o{DUUsfwӶ;s1T,ǤtޒQ\෼J=.tKU,7čJ5 N$y3kdSMQU~mO[03 $zAڟsF5^뜞"Կ QHmrR"ӳηer+ҔZ]hE-6Jmt'ޒ=O[sQj)6K}?e4v_KfZheޓ=BV[bY}lݒTTЬ{ȫvO_qpRApVŗ 6ju=*BR)g "O1yhb=tqJ gtm\b3RY+JQ^Ō֍\յ\>+uSi{=x ^w;uӘ#ĸzLn*$anok߷CBӷ}5Yqvdž<( "_OWit5:EZj2 B ρ1̊fi[n!HQF82q1牙nqnEpT(2RMoM4ϳOu ':֧_Xjsg jP^(ڙ{2%E͖j^}ZU[Q$'U) <܂%!s"m R'G5M0<+zM6qYm$ڕ$3ǧH]?o2N<8F1̻r_my[Rf59NjpzBnl7*{.QP 3N&^BLJPjAHCK2Q}$#~YMq8 k(MFMU)8MEqTy+Tʞ-ar5yܕOXw!e;q-Jqܶ䓊Y:LC UE{/t>r"lI9)3KJjϤA 6SEE$d߇3KG*En|P\ԭTn6I-ƍKTj<1H_zwGr19wF N8ݝ+a9ɫM6mhePi%mmD! """"""*1bRKrD"vnrM۫mmĽm]ӡiG~e"˩ lhRTMk^MX["Jݱk7_ޕ*DqĒ&flՒ}`W}~SմZ{ĕ~wm*/{{ѹ_-0ط#P]xlڱ~Tn5wi*lڪ (JxioϏbqKYR|!|KN53 OS222$jzww%i}>N)E+rۥ7c$Ofl/LNث\6H9: FY󡈾I)fB֔JI_ ֣^: 9mY{66㒢7Uj]:.-os[R&gMF3˸#໹kmjq^8W"PΦURjʄWa˧T!͋ lW48JB2ko+ /Nw QwQzQ ے%$ޓ7^YL|r7!v%Trܥ &|M8~ybrn[RV gSn{{*#2#ԽᢏӴHak" ӌcwҜw&RJ07ױ>Ļ =^ BɆ)v32.M1=#6%̠tҤnzqMwԣ~s*%-j|_m*.Yx9Sz=)qE4 3pk+,`=kNRڥ=B=nŔNAx)Q$ԩȧ4z3t#Z2lҮYn$S%y- JzGpu|LBV7ZW#;Wwipܷ%(6jFG5#{$D"uۭ~]֫SrD܃fҎӾ+Tu>-ZTQ& N|$沸ii>eRWݳu'[O̻j8JۻEѩ[]vni= ڒ,[_%kC7I3Nv$4ɎЈeٸoUu:[}Do5|zNq=Tre%ɧ6&~DȍF]ƞG5q m]/w/ \ʲr8=oʔe9U(W"|S]uZd#?Se[W"ֿh][-7Nu:T=)R}.;ml*5Dlf $fF(̏T hiIUU4Szɕ t(%_|2 ~6eM;TƗK[f&]LK^CE2[ȏBOd;Mi|cx,^6;sیGpQ\NuJIFTJ~đArh* B"$H쉩eXPRj?sl"ԥ)su]xpԴY%VESH"ЋJǰ K&5^Ukzׄ8kEgS2h&Se\ Yl]WҶp-ZUvi7QS:4byqOo+[̺腋[6-_Fo.6[7$p&^ _GZԸߍkc.qqoI[9m߸YxOZЦ1uoiSH)P9Uʄjcq= S>֙NeR><;+ڌk%_qT].srNO?s[=vH[]RZHRMtᩗVؾ:/~u)ԍdg%=edVrISb{6vSu=(ܥ)mTv/J}̇8 S3ad:^hBSf؉OɔLhI_1d8,L><_A0y3rXq"'(۱;mFNII.v5_(^q~X>y{3צ I*Vܛv/jW' T'NR'j%ꔩ:mJ3SB}΋!-H-RJBТQoedi9tjENenPpke.%4]#{:>mkEɱdYWl\\\'nRM4&U>?Ќˉk÷!𴪛]]5}UqG~ݏI"O~s6(Ļ)qO~h}uԕd}Q~G,oE!&G&/]_H-O=o{k\̭bkv.Ô܈+;arZx)m?M\3lU$mk-CFXjTv6u' g:Vn_*qk:VC A%'4JV%EY)#BғO4<e׿jQQ]yUr4=wm[K1r׵%Iũ-O}|kC;/VcݩWZ)EHdžTru]8hgĵ-;=>U_ InvTm_jBM+QiF"9*{DI/iuo(=TzϖmPQl_v4z>T*ȴ>YF;ε\t]EH4ꌇ[VrLzef 2T^V>g2~kg5~Nק;{~Z~W}&ŒBӿS2$J?~(Yœ"˲ߩ\O]: J׉ښT{mmIѩn3˧)4LdFZ/zUG>U> n 5& ϴ-KJi2o]uKljvK3$bԔҚV旧iY5.ίfi96v7!v))FJM4{jG~Jt/lUE%pTAFe4qQk\ve۽/u/Im+W')v{\-E|Pms7߮DZRr۞/mu*1ՙaB܆ -xg3#6ۥtRogʌU)׎]ZҞNnŞr}F1Nnޞ;cZ{N}ۿMiuxʉ*3qi'9KHQ$WJxXyرŔe~[v5~/jN9Q4o6rJv FrdxM*iRjMzUinHdн7ᾞS=S'7 } ̽zt7K|_g J=Lq+/Bw_\ۧx\HJUPzQ<hqF[V0x==CsU7q|^ {)Iq38$_A(VgcKu06Ƅ"%i~_ˉk QCܣB8Ku/񋇵u([w}$F|8TՠI.E !;RJ^}MɒD_q2];Ɖ{5}*n7nEInO{Mwv}&q+v [V}Ĝ@%>#dXQ$f;iep.GquixVt x6bj͵mlKقQ[T]zs/&yەnM'W}!Fp_d^Tu N{ɻ'l{խ2.sTu{W^H&;1s)Pӛ6>$mě;Łnj= fLT)>׸+qReɴ[UR\L*P/!$Ӊ3Q 'K=m~6XqW3^W+ųO_[F$rR*u"T%@O +%# ]˽!aܽz{ͷvQh쩎]hGތ5ɇ*DzJDRNLi 4:{~2FmXY-zzĽ^f=]uū{/+&c:Ma{ĝDp2m܍kHș/(--m_vݮK(V{R}.k&yƴ7i^4@3f sK3^Ř˸B=]?gt5KbZB<e;kQLpxuWC}n 5ҴepB##~q= `x]KWF {GfŲ}?G.I9pjWkU]>={7q{kO/^I3==f1ɏ%nnʫ/Zu_yXN<57ۍ'vy/"8넭M2eԷ&Y,в33%IkjMr7xf nmQkX4踼>a-GcIeތw&U=-:qnW)z¥j :WqSZvԒ#j"KrIU)%qrmRoDGQ~SYRsu*V)  ,/x)MFD6O#]z 96[Ui(JRfw'y$GeUީkdMF-ݻ98F2d[o{Rn0n-xsV6Dh|Eb2E:KCOӪv4SJCr"J!!m,hRLD| ZYFm/X~ΧfrN&4Ƒ=Z9Mh.Mܵw/BdrܥniŪ8ɧ|y%œ[M=_tj?F!z5\evM:\ ~F-sg钬OWq“iiȍ<Gi%%n2rqͻllƑ)okw7}\Uk-:&fj솘XerV9yZuʼşdFC=rmo%~ZN78X(N)_7.Εn1MpJ}62jjJdI";R5&iLԸc:jmqiQj$ujp\{;v5B񥍪Xn Ą4qOERjzN(Ga٠䌡)p*v(J7#ZۻZ8O W uONb+^Qipv9GvֽƼϯrYƖKGJQDNPhRJjᡧC"21"9ѓS1;R_O7/WGz)8fE%F2ukmvSov/iZ&/]~KmI[:^~ͤ\kMi稜\ywJt3W7 8Ʒ~ݥeFgѼw"8VVSج\뻆}ݭ/J6Q)d|)zU3>k\L=;ow֯gN3pKѫ|wmkZ$z^2R:E)f>ς нd|#׆?\ǔpV{;\$ƵE%-ͪm0S6[n< kE[}mvE4DDZ^$OZ0*$~XUv҅B@^?]so#%ojw;Y#SxxueBگy v^i-)s)zV jC{7Gt.w3v,ygg8s]aE_,*E tY5k٨h=o"m泏:\6w噓aiL׎n^c\75AGkЯ0Lf46َ`egZ˓p/k;̛]kq!ݸzpԭG"}R9Ve>ˏHUjJ-&7nrnwG*Xv\˱/vN}O)ʼn&CV͍f̵]r\PMB-6Du-#RͰtRN^)mT _}nSȕC*_xBuTkJW[`ɩ`ejvsngP ڻ.-WUtܑqԹQj)t;vN&RNũT+8%IXӃ5fK՛-d9 ]CƑm|nZ-6=Hz,*aEm W3VzRšdY~Xf׀Xx"]s;)5u*ُHB BRGS6bݶؿ 9j[1*jױga7oX CUI%0v#~\-O-Ꙛuɷ쏪&5mY٦M`LJ2qK~HZbr =N'YobI. (^ ׾{_ ?OJ`S`3BN[}5w6:ǵ/iSlt=4F*d&T4y/#. ɵim5Uֲf 眕6Y7 fơ=3dϕq뚩$qTM-%r!$@A? ޾V0c~{[{;򥧅a~ڵ»&ڄv1ek=wb MLkNAԬw-x>~/r=e73VeVN)K%Sښe"+3uXuچrn ֺVzscJ峻m}vb㶓n\YbIUBT%*,0nov=;z꣓S/nSXSpl##k9mXGrZv^Gde!ŷRԠzQyjC]`gToPov{j~KRBMY}i[߶9KL2ԉO0K#m>wB[ٍ+n[[b٦DX ݲpo] [\m5qdT()mo4Oy9Ie b][wղmM~vmi۱~t \}$яimRk(L c Cvk7r9_r1 ;zv|F@KyZ[&jEji/"6$69ml#e]9s\{ScL}Ȣؿ0q/nZ*t,CLoD߉Njǚy=Pgmu6^]l-["çUʖMlʍp-"qmU>۷uFOJ%Ǔkx 'g=睋k[3u,{³WɘݪF]ՍeFX"Oy\,cچ=w/gn Ļ]#2? vqy-gXnR.^}ݺFs{ŝG]}e|#0mjx"ƬWكm?rgU^xVB":Dt>@LRbun~ݭ,w+v⪕;\U(RYa61>#Jm˞Μ9g9XKaG='u8gf}'qy#ɉw J]We.ʲ-<+&q%s?2dњztҼn`cΤmmqMdz O[-ߩӲ&;[tmܝVnr">{x<8U+p:Ig]zjGkt,uzf}dؠoJaکqEq -(:d<պ=eKy[˗^%ZXkX[C2߱\ITTLGzANM￵i]K>UsOGDDD.ZF6* ҃V Zhz{'xp^`wo8r0h ZmJ5"jb[l=yUu7-;7IT%:jFjߖm0tzU'K)څNۧYJ)4IQ}^KWm7kSP>q;ނ#)'n7&׊r?óM{IwR\j2Qn[v pe#/tAF\ϵ225q֒om6z})6҅*oqDsMf CNIN=T S2t,_ѧ}kveMF0J\Rnnݙܹy[rUc-j{yGtkQ%s]5qB.Nw.JN1LvR Ui5J ZESQԙr):MJ+g}χ!2;q([jAud][ljVK3$ײSJI=/|&tl'*n۽f.frܥ jQO8>&Z];.|7T/C}$ڋUmP2Reҭ8hFF\L 3~e v\۫]ݝNmrnB%*]Z«hKc=BTLG :V74$=Ǘy+EX'4tn(I:Ѝ;Df8c,k1%dJ6.j6ź{N~l6&*fœI7 WAlGOu-ҢH,,(ǔe뿋쩨kM܍ZſgRvQ' 9)?n|er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE&ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ>=F)2[nk؆?훐M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag%qkEUzUgæBhߕP(7]kFnq?֖CpruZ6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p\̅S?㭻;t~R߁)^/>Qj`yt[w ԛ;²~+ߔ_ YW~|o]?x^ᯛ `ʼn;g)T@vWn]>&4lp+$D̢1l|ȨF%-}.9[}w~ ԠLM9hСablfe&QoW!s?wjLK?s7yO>(=C~_nyǜu?v3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw=/7ovuk+\V;lDgն<[A+rX~d;m!_s8ݖ׷;;.0llUC+?i#_crʙ1~C.\–q ul8Hܶ2m`ܻM3Tov|Bs rɵ"oLS- DКw=Tv@f'6|YlD͓Y%׵-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~ &f# }o!muH;ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{ m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ dng>ەZ,Mmϑ :n6nϦezWqUJ4! ۇ4R! =>>Fn|Q[{pRO17ƕ~._I''00k=b՛o}Osðc2'o\3}ݭQ^2 . R1yKȣtAݿ-uܾw!`?1Whn|gzUo[ECWwjUIן)^h#1ɭ!/Z np;o;ΗŻkXs."6E`Z1 עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV2`y/0E˛6+ԫ1? 6}KW c\KoKͨ2ۅFw–s*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* PRaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ ^˒4kƓmzDx \ 'NqamP7nyN݅=j7%McSڵj%STy qXymvCg{w/w=wSW5r̹u erծˊsOm=DhEҚRb#n)QOxtվQwe]I}wCa'"[ۂ-z}2UuKP$㜉ԧ:mc<Ý>RoL?wu|%ҷ&K y_!y9 ??:tq3(UU-lkS'ɸ@jdzQˬR] EVPW1DJq2n:,c|ǻ̑;y{X,ۂ.u.b˕u.tKBjQ"[S園S`ٮdNبeJ&9Ơ ~0a(Vm٘L+Jr*vڑE( x0+tp˕ n';wm-ޜMOxX>{#2%jgb2M[`K*\5@8l'e=0u+w ֘鳾{y܀:R*Ya]"Ӧ%ktynlۣ65,3gU}{GYrb;ge'TKwǘ.,rpܚV]Tr,!dp /ԺU,xՉ>s׽~W5oTh yx?xrrx?)?ilbT׬,z$Ԏ.UH٠\U1pU:]JwSrGZq8àd驐,N67QYBӢD㏙W!Q25ϸo9ms-7-%3CihO.J鯽-;MZM8ku-7k9S$8]q2E(}bۏI[DKOK}3KUB^u %Y,u.-&f#]'܆o$x`Yu,dzwM;#oKxn;\[d7}Rb+*Y䛂ZuBӱl{j0O̓}LhK;[aֶaGL{Cb#S.T[>߃F]NK"u^LUʐ_ykW?!GRj29͖qa'0[npcDvV)qz9R)PۨM^aJx W] r>];eN3vxdmĘ(5W2K1䪖weF{mE/QP6\u54x5[hۮ-Nk”i[lUgL]J}5 S:EhiUrgHl!ŒJ$pe=q^b͵Q' ?6|R\,JA ڵ"TDꈭ:ymg`B5t%M] <N_zv2_Ortٵ/i/ReӮ*7[qүqEG* m"[I:6e^p"I$jԴęh!m)]GZkcjS!{e^z}+Cѥ9;R|/ֱeiUԏCNu2Zhcٗg$ݭwvr P8*7/Lk~I'Km1+MW%Bk|oOm>-#qj*|Dbѱkn|n{v#jĮqNpMIUm(7Liz;{ҜݞڝVƚVϬ+sO!OstGvxӉ']uӎ4g_ 1^-8ۦ k!)Ύ5O;YSB#2Zzχ;<.ֵOtge~.(RC#wFZeGZٸ6FFJ4e2ˇpJT$[wgV)q6muDGJ56q\I!̗ y/I~RtJ9kJ]Iy*'FN0s.[l!fw'y(7$œ WƫgyΙdMEU JQJv̋vmrۖ.jWR_M֨djYgSj0^\y'EoECjm$ IƩK>Z28J2TiJ2N#}.s cArl嫶nB.FIJ.)۔\ZiM>/hLĸ=C1s[?YMqp|94- 鮝𦔽/k^#NT(Y LS$6˩}{;5 )B۷W$qpN)qqoot}ZDVә;7TiK|6f3h$dԄ}fqݡ>Nb򗉉+ͶO]>ߡ_VtYf79ڰիF sq~prս|QM)g%l0ocJȨHz V;Bb/kLAcfPJ,ԭ{ƍgpjNR6VSI*$!yV足jᇑ.](EܣqM\qJ2eZT).<9UB/(B0j)mtKEj#׿fDI-=rZړj|'Nڤ]k*i$5qt"ݙPM6E4ke^Z8ۏhz$Q(R Ay2zfRñnpnkbkI:=j &ΝșW?׵d{+ύM'??XqeeĽ.[o=UxFS=ӷdZwenՄ]_X=ĭVa* pKs0ބۍfJ3 gz̚i|wnxtjc¼5${(1fXQ65ȼb̶Zkn>%FQMJXӡ{TZEVNᖣimT/37cNJUPnP҂ZOE~"-Rc4^b- FEͧtf5[)S!OZIښݲ͑;tvܡ+N)AR=hCNn;wL16-:特7M$=Tҕ-.R[HٷnXk sn[ҞD-0WS9p9:-Ϸ-jѬNu{ҹfv)[Ľvwfg(ٷfe+0mYj8Q1\ݧg]Eǎvڿc!4#j5̋C2"}BRriFp7=ô\TZ:\BLfj#I22װ<;صZl j 6:l"6]۸ K'6RTѯ^ئOԓV\?$x7s#r:Oh{ց=MmuHԷd{pN /܅:UE#Yy+(SgQ(Щ)RHzw>^Ѿݻ>mK&^ '$Jۻ&w%F|xfz%˳ L~3N?Cy9 v w/{ƿ kz3x> sXv}vP"@WyC z`'톽Dw%-tt yVY\wmuPYQA0iG-2JP,6/gˢ]u.-n!Zw.N7Q]Df}Q0({a\@=i_X7gFǘ8^⻲}G MZ1)WEfO12G+=-B@z\`||w6ċj߬m}UwRox֢I &c~XGP6Qndpvܻul'V7^FJt^{b^B(L~sѣ6@߿^xqU!ڙ5|Vpvef-uӥ^3  FSDɯKD%0r}FF穛r7 +o"V8tv̖NQU!5uFd"bCr^bJ=֤fM#ʳԷP0O-9xRBm\=`r-:;~3Tl(nXtXi%2Vٛ#vwqƴ`L@"H‹qW.j,JM5B[)WܺUeZFqc'V˷1W7V̾-MHФwn8N;HPSdݷC7&2j.W\τGŎ'Vb]c.x+Rx1%C2T{myg[qU|+m:M:շ8҉yWd)ՋWS%%:iqlʹmGwݹ WnNŤѩ5(9hTٵDdGUi-)vSs2 2{OnT$Xck n:¶(lASLeȔBjμPpTb2~N2~%^k[ܗ[Jzs0ӓHBKq[}JَA-$dFQgjxxFv4r/x*Rm% `4J(&iv7SkԲmSH1YWmx 8n.k']:Z˭_W >ڃXЩ. jTq%Aā[E}amc]D:rmHRiu:uӚӢ\p(5-q%e)(۬ҖȽIf<߽pr&ݫVfY91q2ĭEQgYbTGQ&,yL+N$[q*RVۉQ=FuTܻ>f>f㋳8N6$܌n)9&»iˤsX,݅܍ȩv+sRTpO}d?Wn/Inpȸ%O]StQO|v5\}7Zwb.AIVK^:wb{[uݯcytO߶S<{8KSRׁH̏N7ۚ[xkwYy_'ZӵF+>쌛ZUĦreE9F[24De{}@:ExWs-\ǻ7K-\JNvEk%:s˙#κ].oͳ;լ7wB6nwu:$L; DkI#Wz.:Xp(˅v$Sq,wn\qIN-e<5Oe+vuYTpcojUI_ާP8 O 7&VL8z$_B-H-[uh]T{|8=qVRN-:Ij:7PUtXϷmy鉿:RIM~33ӸS2#׳GdŲ5+/Bx{(WzȨ5Y㞎#|˖+ ط.|e<o/rߔX>7s}VE.OVti׽ .5nNJO"95{#q}Ay9do]R"M6z\tnNS-D!@3N_jicWsy*5uٮRcWv/.,j}=S)j5C^> Ie =gu9ӛqjtz]۪TMoߧI!Ǧ¶m:,"[L!{qAv-o 3{"KʼnrIkfٶj2ƙ؄S`7` k6jzޞ?e5G&6uʷ2%ԒRKE*G\Npom F/V |C0.q_eenƣ<5Oh'67ɪn[SĽ{ڔjǘzs;~׌(ۂ`ܢ1ƣ` _l9Va6%UQWh~P~\F^ZHR@:ۧCJ{ôGeBh;~ۧnU J\O+n2 RҠ)ng}Kh{5+S×ܛ.1ZjG)iRȤIN 4%{oΜ/eO[Nffd ĹK?nnԼMqX'܌nZvq<ķbFnͪaQ`5 s,M_լ?-@_{w{ӺձJ}GF[%v\5[ŒGkOw/ΜM9rjË%2+rd~+󲕛C9U۳r[aJǭm|˒LAʨSCq[XMۺoubfp:t+ΤĻo ][ zt-*67kvS7D·MMCQXm;)܎n_h%]4ܙnRk!]ڵsDUF"`R, &#R_*[z*ZqFXɻ]7|۵w+'pFDەs=r./ᐚm3Hשy yD"jHCr':sA65نѮ^o1V/ f;nFr3VM)e*- s D'H݅fӧ\*޷[k<7u<-]֍Q8R h|p=WlW3s%Q %3l}@U-K6f-NϿu|ڴmWN׮[׸F*mW\%r! C78:޳vBG7ŵ.JթԚ2x)ST!řn~9 W:Wpܢ件{xf8ٳwKE ҰWxVB\qBZ 2wMb[lGSnyԚ~z9ZmያvoN2Afnݽjf>)j3 !;gOYʹK" Wftڎ+׭b*2ϻK>ۢӱeyԪXISUm[z+ugX%0lϏnvg!;t{BqPj>PyvR7Cj]O%+ݲ :qiMj6W}3vC/R=4Som]ŗ=ю, TF6U_-\6MyskwMr&Q\wjKܩyMϣUj0*}RZܷSdY3>Zjqj6TgzpA/M`/Cmл,޻feE[/+uk^Vs1W$G(JsW2ٰu*߻q*Y޵.Wi:ur5T),=0uRmho.twܖiYwrWHntvEj8qhf`Ͻpf(R&>Ki%I7$QӖm-2 ~yߗQ-앑/ x[k8nw.c㩵k}]FkbJl:{.(˩n0Hqvαp7 귎.Gupx[N`Yq'+ruU7[ү+>!xrȫoSo]OC# d^Q]\>!ƛGw^Mx"-+%vdX-:M2UR%d>%l ioSu6lsj7D P>XxHz Ukà(n^Q V>5cVtWj SEiJdznyej[lE' 3kuٌNn4JW)gB {4 j6&]' m-(ZMEz8cz>WZ6#7+[,MR-Z!4ܓtCyE|umj1ƽvƷV\;%>Q :#Le(iVz5 4ũۤUWxX ^(ҔsլB2w-V ^R+; ˂M\z+Uwr+RWY⺧~ Q*JcYSNSλUd8in=v K낫k\IRרSUaCFmϿ5̗P|u ZTԕ}>oYѲ1sfP+sQkX8Gb~6r,s>^\,mGL+7[n-E\.Fqḕcl*Jmjb5 ,m]c}NXfeVlǸJ5eˡ$4%g~N p4Y*WwW٧<8v#;qԩTut,m"#Y D\5V`\\Lȋ];LȇiS6ϝZ l>LruR\v=ǘϔDg=ԈdFZ+M{=|,[;0>RiSi4,S5}yxw&(E7&fݙ4UՕ! ~'Id)]ǽu2K-fޭ \08Vڅ쓬=Vy^^ IhyKR-B#Ըr=]mܻӾ'*Umkoy rTqT_i,/8Q^<ݤ|4ԻO(܄"'5N~#m.(Ҿ2i6Uev&I*<}҄$eNtÛzyWJubW^iBW.܅Wڮg]irO6Ve90sgv.+sV޿aޔ[p?3q*FutUo*eL\KM'EG*ZcAFfG5J 5jj=MJ3OK:k˝'NMB7m3uFҕ\-Ywg%PRqMIyZGY9|μvn߻5cWݷa^+X֥vnݘ\v7m>Fgzv"-;Ew֝}1|RjN𿊀7g#֟*GQQ|#/bo]p$>_Un9гUbn9׃ErQBU-^vDmVh'<R[fdHT]*~}3j;nvjc7s-rӳ Y8[n[1pJx kX[Jk9Mn!_Nю6x:iZ˦U |߉^Ԛ݃hYxk &U^bwKk.[jE+P(˞=9j@snCv7%c_7=xǁ<l {t'酚+1F‹l׭:ݻILruǶkL-L(K0L1&>wXB(pm;1fpnlp֓%Skidkt(U +xulo'/ڕeN r=^pZZ:Pnj8Hf"48ijY[ N[yZٻ+=  ø:3 ?^ܷ^Sr#YK[UF?CuhC b]GM')mڏsNrܗI]ljq6VB. W,UK"YX5{c >Iqā> T:n!,5l2VzCl|+I[*SrjnS6٨y+x,@>П.g+!rn9>N|W>OZT_ut Y""v7|sfި;Pclm EùN,{'fNT%U&LfH8~1v>Il}统u6P˗c(WV~H^bMU.o*oOF0N:_:6Smr_.b+|ݶYY غF,mwjv>f*>QM뭱Sd:`N{l/⎱;n-z~"Gze퇎J5S KG9!Gn;N1 ݎ h6m|S?ɂ5'WOÞ 7|7^ao @mxGmi^jϽ>01Mf0լD3-2T. VXR"ɥV Kl J O7|u?bvа;6.eߓ|[1bmRr,eRz`z 6܎-ͨku͹Fː dPhYgZUj}nvX;z=gVեTv_J }\1n7w2J?ޘγc\E 1Aޑzq;\r]]\Y&[nsNei\uURje*Qk2CSl*xJz-xٶlm+|UjUؓ`Ladqiĩ!Gd\W~fz;Tn*PdRM&T4`չSWq5k훶(N"Ӎ% V]֦wb.nUO!u*J&Oӕ2e|Z=eV쫚΅g#+/RW:طnbi*Wyo)p{:ETKؚR(RY+r웓r(IF) VmȵNB:h Q1ғ|u8E]{,'$-TR[j49l*3"I鯴zhd>Q+\BkNF=.$ZR4Nwհ(IpNi.(Gi33#33e$FXK*NdWrud[r{xnk$v2ıh+J1TQ[#JQl[tRO]LHKٮ NӍnF񨔤֞Em'MILB"ԋ%dBŋ+p̿_17jzT~4pc Vo\ƹb9Rq-'1j;8ܗ)hE%DZKS<璸Bu*%*Yw5ڻ9ۣ^z4U; Ñk\U(o~G?VUĎ:?P?_F_Kߤ~ᓾI |pr.Ok\SklRhҪz{­P .}SktZ7UQ4ڌIM8̈eaӊJZ%FFZu,KZvln廐SNFIVtuNi?CM5]+Ph,{jN JSR$IS^tSUVrORYu.9WyP6 [Kiu m!X|]Y79ӄ)\ģ)pbڳr%*&ꑶ_-H*dzk)1 V3')UAϹٶWRxe'պn۫h7AR9 EAJeGLms!%D| A 5]/Q3eb̄vnVn%za\m kZnv([emqrIҕij|""><hjJשvvǕ|Pޟs}V~2&Z?+2N&Z4w@)4iSڪ_>/JN9Hiۏuf8'It[ȲR.hZ$ȋ_Y ~U<UUO*6b)Ovzڜj\R̋.$FsQuҊj^נ䈈y<zZIuP[}Qm=C?zN(Exqu/kn S-FzKZzOסӽjJ\)F3b!r5ٝ|;6 o=-3*λ]αb\abqRi-w޵⦪~b8Kpo)Z=>)ғ"5/GTZLE-輵f7ݘ۹~+&+w/7GFI:l33fg.N~۲\2|*cnermnnM+Fq"ѪIz%j =YW8@~gc/~?N'?)«qȸs➟n=k" X“m֮VreMh2[uݖ] *FܖN)MȐ`f0 g,C9̑o;ddudJ=In13:ݒvvdMUEJLp^,6t-@͐9'{7m{-3,>hnF;ѰM)->>+Ěz!R* :`e--m7nB\u{b U>[8֪]6^ߤLʦ\DFNo$$dͶlgno8OrsQ\l̯hRo8tuNo+ CTxu!2[>ctFpeޓƻֶR"3QrQuOѳgwQr;S~)6HhZw/GgVTmUf_yt7%$];zLWF̰xy2Ʉu!MCmš_0[W6jf#a-KLi+3Q7c^qg%s<1aYIQeZf+}>;S6L0]Yu_h9߻<ƅpmiM$AVvŚ,*#t2.8Y)-Zhshü97/#Oro"u^/uFgWɺ,p:6a,^x%$Yve^3PƗMnTP&yS}OJ '덫MH^:rXԴJۋ/rI;S*,+yz1hv)Qw^ڍJ2oL׊q(\fDj:^T%vOadɂnS}ZO)N*λdaȜkG_PIEO}нa(^iQX᯦-7^)%g'SJx(.S9zVɴZ{E ))ۅi/s7 VIV-|sj0*UBTHIqRf>FP$KqN0 R̻8j\GcC}IUz\i 6F)Q{Gҧ3qSzKj-Az VЛS-zy:8*mNk|D鿓ND2u+0Yŝ7kqm·?8Ib]u>˗^_>(]vӋzv+ݩ){vZrJ2RQ몋C$z [,pp,8mڊbR]Il .f~d/ݓs㓓mͶ{mgjQwn=Oic9ܚm4Q/6ݨ[TƧ?nԶoytf{@AzT{e{[O'ZRZt~AGD?s3􌿂ՉIw'|~U\ w~di:Kޱ)U/sU%njѩ&GSP^ǝd)..!^U` 1wX[aԇSxoFV6_扐)T 2Mfd=ۖͭiZ7KK Bi9%7@<3<ճԻU,},a}FRqɛr i@ONJvK KLN M, ʖv0n-]DwlI-X6ܶ$Jʴh5O+mOI+Ra瞠\ MG7BفjYo1#͖0V`Ѱ2M?c8>-Crt*JkIGS:e#hPKx[鱼>{5m;wcն&>j-M֥^َ) 6yȜl_w{-ō̱r> U=]iw3)r*]:K]6BdCTZ|>gf}LW}[$'Y5 &c -j.z6R 67MԷFMnÌwI7w5E}o޽+K ֵy4܌ȥW"COyR[q5Ӱ͙f[v"_#q{MV6܍3"u9BK(41ӯqˇc${ߝCi6I(OmθzҜ5k^:>Jzw.>qV8{vU[ڶEm|DžBz].KHjI]x;Mɗ{m,qZXr忇2u^RO2Z}ZێS[2Jen!*NDcrBUً4<ǼMҲs1Zw57c3&ĖڻzmP*FuJG1-dN:|OU}ҵgi2t~F^^Z.VxjvŧnNNh<:]^~NN+ge^g.SԔGFe߯'[vn'(ScJ]kܗ7eJOlRrfziݮq̋S"\*U<*W]k$FջV}? 7g#֟*GQQ|#/bo]p$>_Un9;l S VvQU%OLU{οmU6bZ1MTx%!֙Q7, J=!3 ;Q,ڌ;6ͱ݅q^&ߔ·n #WbwӖX.HtG)N&d̵zpI,n cu ޖUj+VXUp[w]N o.J6Z8Ts&utxln;~HPHS/xw`G\ʡ¿rj Z^vt"[L:SD\h0sUwR,}[x^X,R2Vn< ]2YDr[SRKs8tXb̷G?Ps Tv 3be,zVz D[/I.KOEQrm'$7|[J>r S`5յwT#\w1FTz\Ԛ &"ׅhSHrD\'r]~/>p;:Piuu:"9ő=tTaS7V2rӷk7mb[^WmPp*[y.Þ6f]cizJCgRR@UVl큝.WJP1N{/\whZ ػϧӱE7|E֫Sί.x-Y&pi%v''-x6r'Ws*6=DwwUu]=C?MK [yrtܒG$!WGqJ*%SAz ED[^)/tė/g=#Omd.|^n/sl׉g DZqemqowݮRzUܜ=ڽ-o/Iۖ;qVʘgPp|mm;6zGl9.8pwWgsJ2qPbe}}UpNjٯ}7TMQKrؽtEx%v w߾8%|j;~|}pK]ơ/ w߾8%|j;~|}pK]ơ/ w&~e_H 8PL7:%ʭ5Kw&U2vwR_+rm'}C7#rWoO&HoG?M$UR7{FU]u ;# !Wk`|W>׹潇9Vn)6)*ҹ{%qV4q>W1vi#T"Qk&GwxcJBJ- Ϸ^ˁxkU}ԣ/3.;]J=<*)cS)ROK9H=,r zX @)cS)Da^ԽQ gxJI=w֣gf*TRj

Corresponding author: Ho-Hyun Son. Department of Conservative Dentistry, College of Dentistry, Seoul National University, 28 Yoengun-dong, Chongro-gu, Seoul, Korea, 110-749. Tel: 82-2-760-1634, Fax: 82-2-760-3859, hhson@snu.ac.kr

Copyright © 2004 Korean Academy of Conservative Dentistry

  • 751 Views
  • 0 Download
prev next
  • The purpose of this study is to monitor the secretion of matrix metalloproteinase-1 (MMP-1) and tissue inhibitor of metalloproteinase-1 (TIMP-1) produced by human osteosarcoma cell line (MG63) stimulated with Prevotella nigrescens lipopolysaccharides (LPS), and to compare the level of secretion before and after the treatment of calcium hydroxide on P. nigrescens LPS.
    LPS was extracted and purified from anaerobically cultured P. nigrescens. MG63 cells were stimulated by the LPS (0, 1, 10 µg/ml) or LPS (10 µg/ml) pretreated with 12.5 mg/ml of Ca(OH)2 for 3 days.
    Total RNA was isolated from the cell, and real-time quantitative polymerase chain reaction (PCR) was performed for quantification of MMP-1 and TIMP-1.
    The results were as follows.
    1. MMP-1 mRNA expression at 48 hr was highly increased by stimulation with P. nigrescens LPS. The increase was dose-dependent.
    2. When stimulated with 1 µg/ml of LPS, TIMP-1 mRNA expression was highly increased at 24 hr and 48 hr. However, TIMP-1 expression was suppressed at higher concentration (10 µg/ml).
    3. When P. nigrescens LPS was pretreated with Ca(OH)2, MMP-1 and TIMP-1 gene expression was downregulated.
    The results of this study suggest that transcriptional regulation of MMP-1 and TIMP-1 by P. nigrescens LPS could be one of the important mechanisms in bone resorption of periapical inflammation. The result of calcium hydroxide on MMP-1 and TIMP-1 gene expression suppression shows that calcium hydroxide detoxified bacterial LPS and thus should be used the medication of choice for intracanal dressings in root canal infected with black-pigmented bacteria.
Accumulation of bacterial byproduct, such as lipopolysaccharide (LPS) in the root canal system can stimulate the host cells in the periapical tissue. These cells such as neutrophils, macrophages and lymphocytes are activated and release inflammatory mediators to initiate and augment subsequent inflammatory reactions leading to periapical tissue breakdown1).
As is the tissue made up of organized group of cells attached to an extracellular matrix, tissue homeostasis is maintained by coordinating cell growth and proliferation with the production and turnover of the extracellular matrix2). It is conceivable that, since the major component of the organic bone matrix is collagen, collagenolytic enzyme, synthesized by osteoblasts, may also participate in the degradation of the mineralized collagen during bone resorption3).
Matrix metalloproteinases (MMPs) are well known proteolytic enzymes for the degradation of extracellular matrix and this proteolysis is believed to play an essential role in the development and progression of pulpal and periapical inflammation4). MMPs, produced by osteoblast-like cells, are likely to be involved in various steps of the bone resorption process5).
Tissue inhibitor of metalloproteinase (TIMP) is also secreted from the same cells that secret MMPs and block the MMP activity6,7). The inhibitor was found in assoication with bone tissue in vitro and in vivo in immunohistochemial and biochemical studies8,9), and these inhibitors have been known to inhibit bone resorption by maintaining a delicate balance with activities of extracellular matrix-degrading MMP10). Resorption of bone may be the results of complex interactions between metalloproteinases and inhibitors produced by cells of bone, a process that is at least in part regulated by local cytokines including bacterial LPS5). By detecting the balance between the level of MMP and their inhibitor activation, one of the host degradative pathways in the pathogenesis of bacterial-derived pulpal and periapical lesion will be revealed.
Recently, it was demonstrated that black-pigmented Bacteroides (BPB) species play an important role in tissue disintegration of extracellular matrix in pulpal and periapical diseases4,11). The cells of these lesions respond to LPS of the organisms and produce various inflammatory mediators. LPS, localized in the cell wall of Gram-negative bacteria, is known to have a broad spectrum of biochemical and immunochemical activities that can lead to the destruction of host tissue12). There are increasing evidences that bacterial LPS treated with calcium hydroxide intaracanal dressings may have altered biological properties13,14).
Among these BPB, Prevotella nigrescens is the most commonly isolated species from the infected root canals, and thought to be related to endodontic infections15-17). However, there were little information concerning the effects of P. nigrescens LPS on the activation of MMPs produced from osteoblast-like cells, and the influence of calcium hydroxide treatment. Thus, the purpose of this study is to monitor the secretion of MMP and TIMP produced by osteoblastic cells stimulated with P. nigrescens LPS and to compare the level of secretion before and after the treatment of calcium hydroxide on P. nigrescens LPS.
1. Bacterial cell culture and purification of lipopolysaccharides
The bacterial strain used was P. nigrescens ATCC33563, and was cultured in brain heart infusion (BHI) broth supplemented with Hemin (10 µg/ml), vitamin K1 (1 µg/ml), and yeast. Bacterial cells were grown anaerobically at 37℃. After sufficient growing, the bacterial cell pellet was obtained by centrifugation at 10,000 × g for 10 min. This pellet was washed with distilled water and then lyophilized. LPS was extracted and purified by the method as described by Eidhin and Mouton in 199318). The lyophilized bacteria was mixed with 1 ml of distilled water and then boiled for 15 min, with 5 min of inverted mixing period. Following centrifugation at 12,000 × g for 5 min, cellular debris was removed, and the supernatant was collected. Then proteinase K (1 mg dissolved in 50 µg/ml water) was added and incubated for 1 h at 60℃. After the tube was boiled for 5 min to precipitate any residual proteinase K, the supernatant was dialyzed against distilled water. After lyophilize the supernatant, the final crude LPS was redissolved to a concentration of 1 mg/ml of distilled water. The purified LPS was confirmed in 12% SDS-PAGE.
2. Osteoblast culture
Human osteogenic sarcoma cell line (MG63) was obtained from the ATCC (CRL-1427). For the experiment, these cells were plated on 100mm dish in α-MEM supplemented with 1 mM sodium pyruvate, 1 mM non-essential amino acid, 10% FBS, and antibiotics at 37℃ in 5% CO2. After confluency, cells were passed on 6 well plate and stimulated by LPS (0, 1, 10 µg/ml) for various periods of time(8, 12, 24 h). In addition, cells were stimulated with LPS (10 µg/ml) pretreated with 12.5 mg/ml of Ca(OH)2 for 3 days.
3. Primer Design
For Real-time PCR amplification, optimal primers were designed using Primer express™ software(PE). They are as follows;
MMP-1 :
  • Forward; 5' ACTGCTGAGTGGCTACCCA 3',

  • Reverse; 5' GCATCCACGGACTGCATATTT 3'

TIMP-1 :
  • Forward; 5' CGCAGCGAGGAGTTCTCATT 3',

  • Reverse; 5' TGCATTCCTCACAGCCAACA 3'

GAPDH :
  • Forward; 5' GAAGGTGAAGGTCGGAGTC3',

  • Reverse; 5' GAAGATGGTGATGGGATTTC 3'

4. Isolation of RNA and real-time PCR assay
After stimulation of cells with LPS and Ca(OH)2 treated LPS for various periods of time, total RNA from the cell was isolated according to the TRIzol Reagent method (Gibco) as described below. The cells were harvested with 0.5 ml of TRIzol reagent and then 100 ml of chloroform was added and inverted mixed. Following centrifugation at 15,000 rpm for 30 min at 4℃, aqueous phase was collected into a fresh tube and mixed with additional 0.25 ml of isopropyl alcohol. After incubation for 10 min on ice, the sample were centrifuged at 15,000 rpm for 10 min at 4℃ to precipitate RNA. The RNA pellet was washed with 1 ml of 75% Ethanol in DEPC and centrifuged at 15,000 rpm for 10 min at 4℃. The isolated RNA was dissolved in DEPC. Extracted total RNA was quantitied using spectrophotometric method to determine the concentration of the primer received. RT reaction mixture containing RT primer, oligo(dT)20 primer, 1 µg of total RNA, Reverse Transcriptase (Invitrogen) was incubated at 42℃ for 50 min, after which the cDNA sample was stored at -20℃. Thermal cycling parameters for RT reactions are as follows; incubation for 10 min at 25℃, RT for 30 min at 48℃, RT inactivation for 5 min at 95℃.
Real-time quantitative PCR was performed by a GeneAmp 5700 sequence detection system(PE, Applied Biosystems) with CYBR Green Master Mix (PE, Applied Biosystems) to assess gene expression. CYBR Green is highly specific to double strand DNA: upon binding to double-strand DNA, it exhibits a large increase in fluorescence. Direct detection of PCR product is monitored by measuring the increase in fluorescence caused by the binding of CYBR Green to double-strand DNA. The reaction mixture (25µL) contains 0.5 µL of the cDNA sample with 0.25 µM of the PCR primer. Two tube method for target genes and control gene (GAPDH) was used in 96 well plate.
The cycle profile was as follows; 1 cycle at 50℃ for 2 min, 1 cycle at 95℃ for I min, 40 cycles at 95℃ for 15 sec, and 60℃ for 1 min. After the last cycle, a dissociation protocol was performed as follows; a hold at 95℃ for 15 sec, a hold at 60℃ for 20 sec, and a slow ramp (20 min) from 60 to 95℃. The dissociation curve was captured during this slow ramp. Experiments were performed in triplicate. The critical threshold cycle (CT) was defined as the cycle at which fluorescence became detectable above the background and was inversely proportional to the logarithm of the initial number of template molecules. A standard curve was plotted for each primer set with CT values obtained from amplification of known quantities of the genomic DNA. By the standard curve of CT vs (logN) starting copy number for all standards, it can be determined the starting copy number of unknowns by interpolation.
After stimulated with 0, 1, 10 µg /ml of Prevotella nigrescens LPS at 8, 24 and 48 h, total mRNA of MMP-1 and TIMP-1 were isolated and evaluated by RT-PCR. The threshold cycle was detected and normalized with control gene, GAPDH. The expression of GAPDH was used to compare assay reproducibility utilizing the ratio between raw data and normalized expression as a percent coefficient by employing PCR. The ratio between RNA content and GAPDH of each sample was shown in Table 1 and 2. (Figure 1, 2)
According to the data, MMP-1 gene expression at 48 h was highly increased under the stimulation of both 1 and 10 µg/ml of P. nigrescens LPS. (Table 1, Figure 3). The increase was dose-dependent.
When stimulated with 1 µg/ml of bacterial LPS, TIMP-1 mRNA expression was highly increased at 24 h and 48 h. However, TIMP-1 secretion was suppressed at higher concentration (10 µg/ml) of bacterial LPS (Figure 4).
When P. nigrescens LPS was pretreated with Ca(OH)2, MMP-1 and TIMP-1 gene expression was downregulated (Table 3 and 4, Figure 5 and 6).
A hallmark of periapical disease is its ability to degrade the surrounding extracellular matrix, resulting in distruction of bone in the periapical tissue. There are increasing evidences that MMPs are essential enzymes responsible for degradation of extracellular matrix in the pathological conditions associated with inflammations19). Numerous studies have examined MMPs secreted from periodontal ligament fibroblast20-22) and correlated the level of expression with the invasive ability of the disease4,6). Individual osteoblasts, like fibroblasts, are capable of both synthesizing and degrading their respective organic matrices in vivo23). MMPs and TIMPs are known to be important in homeostatic matrix remodeling by osteoblasts.
However, MMP and TIMP production under stimulation of bacterial LPS in osteoblastic cell has not been well studied.
Conflicting reports exist concerning the production of MMP-1 by normal human osteoblasts. Rifas et al. reported that human osteoblasts are unable to produce MMP-1 either constitutively or in respons to bone resorptive agents24). De Bart et al. also reported that the mRNA for MMP-1 was not detectable under normal conditions in MG63 cells by Northern blot analysis25).
In the present study, the expression of MMP-1 mRNA was low, but obvious in the negative control. This result consisted with the findings of Panagakos et al. that the expression of MMP-1 was low and essentially invariant over a culture period of human osteoblastic cell line26). This constitutive MMP-1 seems to serve as a remodeling element of connective tissue under physiological conditions27). Otsuka et al. also demonstrated that rat osteosarcoma cell line produced collagenolytic enzymes23).
MMP-1 mRNA was highly expressed in this study after 48 h stimulated with Prevotella nigrescens LPS, and the increase was dose-dependent. The results consisted with many other studies. Nakata et al. demonstrated that the production of MMP-1 was accelerated by sonicated bacterial extracts28). Shin et al. also confirmed this result by detecting high concentration of MMP-1 in relation to clinical symptoms29).
The activity of MMPs is under strict regulation by a group of tissue inhibitor of metalloproteinases(TIMPs), of which TIMP-1 to TIMP-4 have been identified30). TIMP-1, a glycoprotein with a molecular mass of 28kDa, can form a stoichiometric 1:1 complex with MMP-1 and inhibit the activity of MMP-119). Because the same cells that produce MMP-1 are also capable of synthesizing TIMP-1, the overall molar ratio between MMP-1 and TIMP-1 plays a critical role in connective tissue remodeling31).
In this study, TIMP-1 was expressed by MG-63 osteoblastic cells. Otsuka23), Johansen32), Uchida33). also reported that osteoblastic cells synthesized TIMP-1. These results back up our findings.
During the experimental period of time, TIMP-1 expression was highly increased at 24 h and 48 h under the 1 µg/ml of P. nigrescens LPS. However, TIMP-1 secretion was suppressed when exposed to higher concentration (10 µg/ml) of bacterial LPS. The reason of the downregulation of TIMP-1 could be a perturbation in cell-extracellular matrix interaction by the high virulence of bacterial LPS and in turn it culminated in tissue destruction. A better understanding of TIMP activity will be helpful in understanding the etiology of the periapical lesion and its treatment strategies.
LPS is known to exert profound effect on the protein expression by host cells. Wahl et al. has demonstrated that LPS stimulates collagenase release via a mechanism involving PGE2 and cAMP34). This can be the one of the mechanisms that bacterial LPS affect on the development of periapical bone resorption. Prevotella nigrescens LPS was used in this study because infection of the root canals is frequently associated with BPBs and among the isolated black-pigmented bacteroides species, this microorganism is most often isolated from infections of endodontic origin15,17). Gharbia et al. also reported that P. nigrescens is the predominant cultivable BPB from both coronal and apical portions of infected root canals16). E.coli LPS was used as a positive control because its chemical structure and stimulatory effects have been investigated extensively12).
There have been increasing evidences that calcium hydroxide may detoxify bacterial LPS by altering its biological properties13,14,35). Use of calcium hydroxide as a routine intracanal dressing has been advocated in recent years. Calcium hydroxide treatment was effective in suppression of devastating effect of MMP in this study. The fact that the expression of MMP was downregulated when stimulated with either P. nigrescens or control E. coli LPS pretreated with calcium hydroxide indicate that it is effective in preventing extracellular matrix degradation by reducing MMP production from osteoblast. Calcium hydroxide seems to be clinically beneficial when LPS is suspected in the root canal.
The mRAN expressions of MMP-1 and TIMP-1 produced by Human osteosarcoma cell line (MG63) stimulated with P. nigrescens LPS (0, 1, 10 µg/ml) and calcium hydroxide, pretreated P. nigrescens LPS (10 µg/ml) for various periods of time, were monitored by real-time PCR.
The results were as follows.
  1. MMP-1 mRNA expression at 48 h was highly increased by stimulation with P. nigrescens LPS. The increase was dose-dependent.

  2. When stimulated with 1 µg/ml of LPS, TIMP-1 mRNA expression was highly increased at 24 h and 48 h. However, TIMP-1 expression was suppressed at higher concentration (10 µg/ml).

  3. When P. nigrescens LPS was pretreated with Ca(OH)2, MMP-1 and TIMP-1 gene expression was downregulated.

The results of this study are suggestive that transcriptional regulation of MMP-1 and TIMP-1 by P. nigrescens LPS is one of the important mechanisms in bone resorption of periapical inflammation. The result of calcium hydroxide on MMP-1 and TIMP-1 gene expression suppression shows that calcium hydroxide detoxified bacterial LPS and thus should be used as a medication of choice for intracanal dressings in root canal infected with black-pigmented bacteria.
  • 1. Trowbridge HO. Immunological aspects of chronic inflammation and repair. J Endod. 1990;16: 54-61.ArticlePubMed
  • 2. Yang YY, Tsai HF, Lu SC, Huang YF, Chang YC. Regulation of tissue inhibitors of metalloproteinase-1 gene expression by cytokines in human gingival fiboblasts. J Endod. 2002;28: 803-805.PubMed
  • 3. Overall CM, Sodek J. Initial characterization of a neutral metalloproteinase, active of native 3/4 collagen fragments, synthesized by ROS 17/2.8 osteoblastic cells, periodontal fibroblasts, and Identified in gingival crevicular fluid. J Dent Res. 1987;66: 1271-1282.ArticlePubMedPDF
  • 4. Chang YC, Lai CC, Yang SF, Chan Y, Hsieh YS. Stimulation of matrix metalloproteinases by black-pigmented bacteroides in human pulp and periodontal ligament cell cultures. J Endod. 2002;28: 90-93.ArticlePubMed
  • 5. Van der Zee E, Jansen I, Hoeben K, Beertsen W, Everts V. EGF and IL-1α modulate the release of collagenase, gelatinase and TIMP-1 as well as the release of calcium by rabbit calvarial bone explants. J Periodontal Res. 1998;33: 65-72.ArticlePubMed
  • 6. Cury JD, Campbell EJ, Lazarus CJ, Albin RJ, Welgus HG. Selective up-regulation of human alveolar macrophage collagenase production by lipopolysaccharide and comparison to collagenase production by fibroblasts. J Immunol. 1988;141: 4306-4312.ArticlePubMedPDF
  • 7. Séguier S, Gogly B, Bodineau A, Godeau G, Brousse N. Is collagen breakdown during periodontitis linked to inflammatory cells and expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in human gingival tissue? J Periodontol. 2001;72: 1398-1406.ArticlePubMed
  • 8. Lin SK, Chiang CP, Hong CY, Lin CP, Lan WH, Hsieh CC, Kuo MYP. Immunolocalization of interstitial collagenase(MMP-1) and tissue inhibitor of metalloproteinase-1(TIMP-1) in radicular cysts. J Oral Pathol Med. 1997;26: 458-463.PubMed
  • 9. Everts V, Hoegen K, Beertsen W. The release of tissue inhibitor of metalloproteinases by calvarial bone explants and its immunolicalizaiton. Bone Miner. 1993;22: 43-55.PubMed
  • 10. Hill PA, Reynolds JJ, Meikle MC. Inhibition of stimulated bone resorption in vitro by TIMP-1 and TIMP-2. Biochem Biophys Acta. 1993;1177: 71-74.ArticlePubMed
  • 11. Hosoya S, Matsushima K. Stimulation of interleukin-1β production of human dental pulp cells by Porphylomonas endodontalis lipopolysaccharides. J Endod. 1997;23: 39-42.PubMed
  • 12. Koga T, Nishihara T, Fujiwara T, Nisizawa T, Okahashi N, Noguchi T, Hamada S. Biochemical and immunological properties of lipopolysaccharide(LPS) from Bacteroides gingivalis and comparison with LPS from Escherichia coli. Infect Immun. 1985;47: 638-647.ArticlePubMedPMCPDF
  • 13. Safavi KE, Nichols FC. Alteration of biological properties of bacterial lipopolysaccharide by calcium hydroxide treatment. J Endod. 1994;20: 127-129.ArticlePubMed
  • 14. Safavi KE, Nichols FC. Effects of calcium hydroxide on bacterial lipopolysaccharide. J Endod. 1993;19: 76-78.PubMed
  • 15. Baumgartner JC, Watkins BJ, Bae KS, Xia T. Association of black-pigmented bacteria with endodontic infections. J Endod. 1999;25: 413-415.ArticlePubMed
  • 16. Gharbia SE, Haapasalo M, Shah H, et al. Characterization of Prevotella intermedia and Prevotella nigrescens isolates from periodontic and endodontic origin. J Periodontol. 1994;65: 56-61.PubMed
  • 17. Bae KS, Baumgartner JC, Shearer TR, David LL. Occurrence of Prevotella nigrescens and Prevotella intermedia in infections of endodontic origin. J Endod. 1997;23: 620-623.ArticlePubMed
  • 18. Eidhin DN, Mouton C. A rapid method for preparation of rough and smooth lipopolysaccharides from Bacteroides, Porphylomonas and Prevotella. FEMS Microbiol Lett. 1993;110: 133-138.PubMed
  • 19. Birkedal-Hansen H, Moore WBI, Bodden MK, Winsor LJ, Brikedal-Hansen B, DeCarlo A, Engler JA. Matrix metalloproteinases: A review. Crit Rev Oral Biol Med. 1993;4: 197-250.ArticlePubMedPDF
  • 20. Alvares O, Klebe R, Grant G, Cochran DL. Growth factor effects on the expression of collagenase and TIMP-1 in periodontal ligament cells. J Periodontol. 1995;66: 552-558.ArticlePubMedPDF
  • 21. Bolcato-Bellemin AL, Elkaim R, Abehsera A, Fausser JL, Haikel Y, Tenenbaum H. Expression of mRNAs encoding for α and β integrin subunit, MMPs, and TIMPs in stretched human periodontal ligament and gingival fibroblast. J Dent Res. 2000;79: 1712-1716.ArticlePubMedPDF
  • 22. Nakaya H, Osawa G, Iwasaki N, Cochran DL, Kamoi K, Oates TW. Effects of bisphophonate enzymes in human periodontal ligament cells. J Periodontol. 2000;71: 1158-1166.PubMed
  • 23. Otsuka K, Sodek J, Limeback H. Synthesis of collagenase and collagenase inhibitors by osteoblast-like cells in culture. Eur J Biochem. 1984;145: 123-129.ArticlePubMed
  • 24. Rifas L, Halstead LR, Peck WA. Human osteoblasts in vitro secrete tissue inhibitor of metalloproteinases and gelatinase but not interstitial collagenase as major cellular products. J Clin Invest. 1989;84: 686-694.ArticlePubMedPMC
  • 25. de Bart AC, Quax PHA, Lowik CWGM, Verheijen . Regulation of plasminogen activation, matrix metalloproteinases and urokinase-type plasminogen activator-mediated extracellular matrix degradation in human osteosarcoma cell line MG63 by interleukin-1 alpha. J Bone Miner Res. 1995;10: 1374-1384.ArticlePubMedPDF
  • 26. Panagakos FS, Kumar S. Modulation of proteases by extracellular matrix and tumor necrosis factor-alpha. Inflammation. 1995;19: 423-443.ArticlePubMedPDF
  • 27. Lin SK, Wang CC, Huang S, Lee JJ, Chiang CP, Lan WH, Hong CY. Induction of dental pulp fibroblast matrix metalloproteinase-1 and tissue inhibitor of metalloproteinase-1 gene expression by interleukin-1α and tumor necrosis factor-α through a prostaglandin-dependent pathway. J Endod. 2001;27: 185-189.ArticlePubMed
  • 28. Nakata K, Yamasaki M, Iwata T, Suzuki K, Nakane A, Nakamura H. Anaerobic bacterial extracts influence production of matrix metalloproteinases and their inhibitors by human dental pulp cells. J Endod. 2000;26: 410-413.ArticlePubMed
  • 29. Shin SJ, Lee JI, Baek SH, Lim SS. Tissue levels of matrix metalloproteinases in pulps and periapical lesions. J Endod. 2002;28: 313-315.ArticlePubMed
  • 30. Douglas DA, Shi YE, Sang QA. Computational sequence analysis of the tissue inhibitor of metalloproteinase family. J Protein Chem. 1997;16: 237-255.PubMed
  • 31. Dean DD, Martel-Pelletier J, Pelletier JP, Howell DS, Woessner JF Jr. Evidence for metalloproteinase and metalloproteinase inhibitor imbalance in human osteoarthritic cartilage. J Clin Invest. 1989;84: 678-685.ArticlePubMedPMC
  • 32. Johansen JS, Williamson MK, Rice JS, Price PA. Identification of proteins secreted by human osteoblastic cells in culture. J Bone Miner Res. 1992;7: 501-512.ArticlePubMedPDF
  • 33. Uchida M, Shima M, Shimoaka T, Fujieda A, Obara K, Suzuki H, Nagai Y, Ikeda T, Yamato H, Kawaguchi H. Regulation of matrix metalloproteinases(MMPs) and tissue inhibitors of metalloproteinases (TIMPs) by bone resorptive factors in osteoblastic cells. J Cell Physiol. 2000;185: 207-214.ArticlePubMed
  • 34. Wahl LM, Olsen SE, Sandberg AL, Mergenhagen SE. Prostaglandin regulation of macrophage collagenase production. Proc Natl Acad Sci USA. 1977;74: 4955-4958.ArticlePubMedPMC
  • 35. Buck RA, Cai J, Eleazer PD, Staat RH, Hurst HE. Detoxification of endotoxin by endodontic irrigants and calcium hydroxide. J Endod. 2001;27: 325-327.ArticlePubMed
Figure 1
Amplification plots of real time PCR for MMP-1. Dashed line (--x--) indicates the threshold cycle.
jkacd-29-470-g001.jpg
Figure 2
Amplification plots of real time PCR for TIMP-1. Dashed line (--x--) indicates the threshold cycle.
jkacd-29-470-g002.jpg
Figure 3
MMP-1 gene expression relative to GAPDH at different LPS concentrations (µg/ml) and different periods of time.
jkacd-29-470-g003.jpg
Figure 4
TIMP-1 gene expression relative to GAPDH at different LPS concentrations (µg/ml) and different periods of time.
jkacd-29-470-g004.jpg
Figure 5
MMP-1 gene expression relative to GAPDH in osteoblasts stimulated with 10 µg/ml of P. nigrescens LPS pretreated with Ca(OH)2 at different periods of time.
jkacd-29-470-g005.jpg
Figure 6
TIMP-1 gene expression relative to GAPDH in osteoblasts stimulated with 10 µg/ml of P. nigrescens LPS pretreated with Ca(OH)2 at different periods of time.
jkacd-29-470-g006.jpg
Table 1
The ratio between the mRNA expression of MMP-1 and GAPDH in osteoblast stimulated with P. nigrescens LPS. The data were acquired in triplicate of each sample.
jkacd-29-470-i001.jpg
Table 2
The ratio between the mRNA expression of MMP-1 and GAPDH in osteoblast stimulated with P. nigrescens LPS. The data were acquired in triplicate of each sample.
jkacd-29-470-i002.jpg
Table 3
The ratio between the mRNA expression of MMP-1 and GAPDH in osteoblast-like cells stimulated with P. nigrescens LPS pretreated with Ca(OH)2. The data were acquired in triplicate of each sample.
jkacd-29-470-i003.jpg
Table 4
The ratio between the mRNA expression of TIMP-1 and GAPDH in osteoblast-like cells stimulated with P. nigrescens LPS pretreated with Ca(OH)2. The data are acquired in triplicate of each sample.
jkacd-29-470-i004.jpg

Tables & Figures

REFERENCES

    Citations

    Citations to this article as recorded by  

      • ePub LinkePub Link
      • Cite
        CITE
        export Copy Download
        Close
        Download Citation
        Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

        Format:
        • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
        • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
        Include:
        • Citation for the content below
        MMP-1 and TIMP-1 production in MG-63 cells stimulated with Prevotella nigrescens lipopolysaccharide
        J Korean Acad Conserv Dent. 2004;29(5):470-478.   Published online September 30, 2004
        Close
      • XML DownloadXML Download
      Figure
      • 0
      • 1
      • 2
      • 3
      • 4
      • 5
      MMP-1 and TIMP-1 production in MG-63 cells stimulated with Prevotella nigrescens lipopolysaccharide
      Image Image Image Image Image Image
      Figure 1 Amplification plots of real time PCR for MMP-1. Dashed line (--x--) indicates the threshold cycle.
      Figure 2 Amplification plots of real time PCR for TIMP-1. Dashed line (--x--) indicates the threshold cycle.
      Figure 3 MMP-1 gene expression relative to GAPDH at different LPS concentrations (µg/ml) and different periods of time.
      Figure 4 TIMP-1 gene expression relative to GAPDH at different LPS concentrations (µg/ml) and different periods of time.
      Figure 5 MMP-1 gene expression relative to GAPDH in osteoblasts stimulated with 10 µg/ml of P. nigrescens LPS pretreated with Ca(OH)2 at different periods of time.
      Figure 6 TIMP-1 gene expression relative to GAPDH in osteoblasts stimulated with 10 µg/ml of P. nigrescens LPS pretreated with Ca(OH)2 at different periods of time.
      MMP-1 and TIMP-1 production in MG-63 cells stimulated with Prevotella nigrescens lipopolysaccharide

      The ratio between the mRNA expression of MMP-1 and GAPDH in osteoblast stimulated with P. nigrescens LPS. The data were acquired in triplicate of each sample.

      The ratio between the mRNA expression of MMP-1 and GAPDH in osteoblast stimulated with P. nigrescens LPS. The data were acquired in triplicate of each sample.

      The ratio between the mRNA expression of MMP-1 and GAPDH in osteoblast-like cells stimulated with P. nigrescens LPS pretreated with Ca(OH)2. The data were acquired in triplicate of each sample.

      The ratio between the mRNA expression of TIMP-1 and GAPDH in osteoblast-like cells stimulated with P. nigrescens LPS pretreated with Ca(OH)2. The data are acquired in triplicate of each sample.

      Table 1 The ratio between the mRNA expression of MMP-1 and GAPDH in osteoblast stimulated with P. nigrescens LPS. The data were acquired in triplicate of each sample.

      Table 2 The ratio between the mRNA expression of MMP-1 and GAPDH in osteoblast stimulated with P. nigrescens LPS. The data were acquired in triplicate of each sample.

      Table 3 The ratio between the mRNA expression of MMP-1 and GAPDH in osteoblast-like cells stimulated with P. nigrescens LPS pretreated with Ca(OH)2. The data were acquired in triplicate of each sample.

      Table 4 The ratio between the mRNA expression of TIMP-1 and GAPDH in osteoblast-like cells stimulated with P. nigrescens LPS pretreated with Ca(OH)2. The data are acquired in triplicate of each sample.


      Restor Dent Endod : Restorative Dentistry & Endodontics
      Close layer
      TOP